From AureoWiki
Jump to: navigation, search

NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS04010 [old locus tag: SA0705 ]
  • pan locus tag?: SAUPAN002659000
  • symbol: SA_RS04010
  • pan gene symbol?: comFA
  • synonym:
  • product: comf operon protein 1

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA_RS04010 [old locus tag: SA0705 ]
  • symbol: SA_RS04010
  • product: comf operon protein 1
  • replicon: chromosome
  • strand: +
  • coordinates: 803615..804697
  • length: 1083
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002745 (803615..804697) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    ATGGATAATGTAACAAGATATAAAATAACAGAGAGTTCGCAAAGTTCATCACAAGCATAT
    TATCATCTCTCATTTGAATTGTCGGAACAGCAGTCTTATGCCTCAGAACATATTGTTCGA
    GCCATTAGAATGAGACAAACGATTTTGTTATATGCCGTAACAGGTGCAGGTAAGACAGAA
    ATGATGTTTCAAGGCATTCAATATGCAAGACGACAGGGAGATAATATAGCTATTGTGTCA
    CCGCGTGTAGATGTTGTTGTAGAAATTAGTAAACGTATTAAAGACGCATTTCTTAATGAA
    GATATAGACATACTACACCAGCAATCAAGTCAACAATTTGAAGGGCATTTTGTTGTATGC
    ACAGTACATCAACTTTACCGATTCAAACAGCACTTTGATACTATTTTTATTGATGAAGTC
    GATGCCTTTCCTTTATCAATGGATAAAAGTTTACAACAAGCATTGAAGTCATCTTCTAAA
    GTTGAACATGCAACGATTTATATGACAGCAACACCACCGAAACAACTTCTGTCAGAGATT
    CCCCACGAAAATATAATTAAATTGCCAGCTCGCTTTCATAAAAAATCACTTCCAGTTCCT
    AAATATCGTTATTTCAAACTTAATAATAATAAGATTCAGAAAATGTTATACCGAATTTTA
    CAAGATCAAATTAATAATCAACGTTATACACTGGTGTTTTTTAACAATATAGAAACAATG
    ATTAAAACATTTTCGGTTTATAAGCAGAAAATTACTAAATTAACATACGTCCATAGCGAG
    GATGTTTTTCGCTTTGAAAAAGTTGAACAATTAAGGAATGGACATTTCGATGTCATTTTT
    ACTACGACAATATTAGAACGTGGATTTACAATGGCAAATTTGGATGTTGTTGTTATCGAT
    GCACATCAATATACTCAAGAGGCTTTAATACAAATTGCTGGACGTGTTGGACGAAAATTA
    GAATGTCCTGCTGGAAAAGTATTGTTTTTTCATGAAGGAGTAAGTATGAATATGATTCAA
    GCTAAAAAAGAGATTCAAAGGATGAACAAATTAGCATTAAAAAGAGGTTGGATTGATGAA
    TAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1083

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA_RS04010 [old locus tag: SA0705 ]
  • symbol: SA_RS04010
  • description: comf operon protein 1
  • length: 360
  • theoretical pI: 9.69237
  • theoretical MW: 42017.2
  • GRAVY: -0.329167

Function[edit source | edit]

  • TIGRFAM:
    CRISPR-associated helicase Cas3 (TIGR01587; HMM-score: 54.1)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairexcinuclease ABC subunit B (TIGR00631; EC 3.1.25.-; HMM-score: 46)
    and 4 more
    Genetic information processingDNA metabolismDNA replication, recombination, and repairprimosomal protein N' (TIGR00595; EC 3.6.1.-; HMM-score: 31.4)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairtranscription-repair coupling factor (TIGR00580; EC 3.6.1.-; HMM-score: 20.2)
    helicase/secretion neighborhood putative DEAH-box helicase (TIGR03817; HMM-score: 19.7)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA threonylcarbamoyl adenosine modification protein YjeE (TIGR00150; HMM-score: 14.2)
  • TheSEED:
  • PFAM:
    P-loop_NTPase (CL0023) ResIII; Type III restriction enzyme, res subunit (PF04851; HMM-score: 44.6)
    Helicase_C; Helicase conserved C-terminal domain (PF00271; HMM-score: 44.3)
    and 11 more
    DEAD; DEAD/DEAH box helicase (PF00270; HMM-score: 25.3)
    Flavi_DEAD; Flavivirus DEAD domain (PF07652; HMM-score: 21.4)
    no clan definedPrpR_N; Propionate catabolism activator (PF06506; HMM-score: 21.3)
    P-loop_NTPase (CL0023) Helicase_RecD; Helicase (PF05127; HMM-score: 20.2)
    AAA_19; AAA domain (PF13245; HMM-score: 19)
    UvrD-helicase; UvrD/REP helicase N-terminal domain (PF00580; HMM-score: 18.4)
    AAA_30; AAA domain (PF13604; HMM-score: 16.8)
    T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 13.9)
    AAA_24; AAA domain (PF13479; HMM-score: 12.4)
    Terminase_GpA; Phage terminase large subunit (GpA) (PF05876; HMM-score: 11)
    Glyco_hydro_tim (CL0058) Glyco_hydro_70; Glycosyl hydrolase family 70 (PF02324; HMM-score: 10.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.146
    • Ymax_pos: 35
    • Cmax: 0.226
    • Cmax_pos: 35
    • Smax: 0.213
    • Smax_pos: 1
    • Smean: 0.098
    • D: 0.127
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 486217175 NCBI
  • RefSeq: WP_001557172 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MDNVTRYKITESSQSSSQAYYHLSFELSEQQSYASEHIVRAIRMRQTILLYAVTGAGKTEMMFQGIQYARRQGDNIAIVSPRVDVVVEISKRIKDAFLNEDIDILHQQSSQQFEGHFVVCTVHQLYRFKQHFDTIFIDEVDAFPLSMDKSLQQALKSSSKVEHATIYMTATPPKQLLSEIPHENIIKLPARFHKKSLPVPKYRYFKLNNNKIQKMLYRILQDQINNQRYTLVFFNNIETMIKTFSVYKQKITKLTYVHSEDVFRFEKVEQLRNGHFDVIFTTTILERGFTMANLDVVVIDAHQYTQEALIQIAGRVGRKLECPAGKVLFFHEGVSMNMIQAKKEIQRMNKLALKRGWIDE

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA_RS04010 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]