Jump to navigation
Jump to search
NCBI: 26-AUG-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA1100 [new locus tag: SA_RS06235 ]
- pan locus tag?: SAUPAN003557000
- symbol: tsf
- pan gene symbol?: tsf
- synonym:
- product: elongation factor Ts
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SA1100 [new locus tag: SA_RS06235 ]
- symbol: tsf
- product: elongation factor Ts
- replicon: chromosome
- strand: +
- coordinates: 1246148..1247029
- length: 882
- essential: yes [1] DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 1123931 NCBI
- RefSeq: NP_374373 NCBI
- BioCyc: see SA_RS06235
- MicrobesOnline: 103399 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841ATGGCAACTATTTCAGCAAAACTTGTTAAAGAATTACGTAAAAAAACTGGCGCGGGTATG
ATGGATTGTAAAAAAGCGCTAACTGAAACTGATGGTGACATCGATAAAGCGATTGATTAC
CTACGTGAAAAAGGTATTGCTAAAGCAGCTAAAAAAGCAGACCGTATTGCGGCTGAAGGT
TTAGTACATGTAGAAACTAAAGGTAACGACGCAGTTATCGTTGAAATCAACTCTGAAACA
GACTTTGTTGCTCGTAACGAAGGATTCCAAGAGTTAGTTAAAGAAATCGCTAATCAAGTA
TTAGATACAAAAGCTGAAACTGTTGAAGCTTTAATGGAAACAACTTTACCAAATGGTAAA
TCAGTTGATGAAAGAATTAAAGAAGCAATTTCAACAATCGGTGAAAAATTAAGTGTTCGT
CGTTTTGCTATCAGAACTAAAACTGATAACGATGCTTTCGGCGCTTACTTACACATGGGT
GGACGCATTGGTGTATTAACAGTTGTTGAAGGTTCAACTGACGAAGAAGCAGCAAGAGAC
GTTGCTATGCATATCGCTGCAATCAACCCTAAATATGTTTCTTCTGAACAAGTTAGCGAA
GAAGAAATCAACCACGAAAGAGAAGTTTTAAAACAACAAGCATTAAATGAAGGTAAACCA
GAAAACATCGTTGAAAAAATGGTGGAAGGACGTTTACGTAAATACTTACAAGAAATTTGT
GCTGTAGATCAAGACTTCGTTAAAAACCCTGATGTAACAGTTGAAGCTTTCTTAAAAACA
AAAGGTGGAAAACTTGTTGACTTCGTACGCTATGAAGTAGGCGAAGGTATGGAAAAACGC
GAAGAAAACTTTGCGGATGAAGTTAAAGGACAAATGAAATAA60
120
180
240
300
360
420
480
540
600
660
720
780
840
882
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA1100 [new locus tag: SA_RS06235 ]
- symbol: Tsf
- description: elongation factor Ts
- length: 293
- theoretical pI: 4.88154
- theoretical MW: 32492.7
- GRAVY: -0.477816
⊟Function[edit | edit source]
- TIGRFAM: Protein synthesis Translation factors translation elongation factor Ts (TIGR00116; HMM-score: 388.7)and 2 moreUnknown function General DNA-binding protein, YbaB/EbfC family (TIGR00103; HMM-score: 15.1)pectinesterase inhibitor domain (TIGR01614; HMM-score: 10.7)
- TheSEED :
- Translation elongation factor Ts
- PFAM: no clan defined EF_TS; Elongation factor TS (PF00889; HMM-score: 267)and 9 moreEF-Ts_N; Elongation factor Ts, mitochondrial, N-terminal (PF25025; HMM-score: 32.4)UBA (CL0214) UBA_HOIP; HOIP UBA domain pair (PF16678; HMM-score: 15.8)no clan defined Tcp11; T-complex protein 11 (PF05794; HMM-score: 14.9)DUF3150; Protein of unknown function (DUF3150) (PF11348; HMM-score: 14.7)UBA (CL0214) HBS1_N; HBS1 N-terminus (PF08938; HMM-score: 14.4)no clan defined Ku_C; Ku70/Ku80 C-terminal arm (PF03730; HMM-score: 13.9)UBA (CL0214) UBA; UBA/TS-N domain (PF00627; HMM-score: 13)ACT (CL0070) NIL; NIL domain (PF09383; HMM-score: 12.7)RIIa (CL0068) RIIa; Regulatory subunit of type II PKA R-subunit (PF02197; HMM-score: 11.5)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9976
- Cytoplasmic Membrane Score: 0
- Cell wall & surface Score: 0
- Extracellular Score: 0.0024
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.00662
- TAT(Tat/SPI): 0.000834
- LIPO(Sec/SPII): 0.001814
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MATISAKLVKELRKKTGAGMMDCKKALTETDGDIDKAIDYLREKGIAKAAKKADRIAAEGLVHVETKGNDAVIVEINSETDFVARNEGFQELVKEIANQVLDTKAETVEALMETTLPNGKSVDERIKEAISTIGEKLSVRRFAIRTKTDNDAFGAYLHMGGRIGVLTVVEGSTDEEAARDVAMHIAAINPKYVSSEQVSEEEINHEREVLKQQALNEGKPENIVEKMVEGRLRKYLQEICAVDQDFVKNPDVTVEAFLKTKGGKLVDFVRYEVGEGMEKREENFADEVKGQMK
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
SA1533 (ackA) acetate kinase [2] (data from MRSA252) SA1984 (asp23) alkaline shock protein 23 [2] (data from MRSA252) SA1517 (citC) isocitrate dehydrogenase [2] (data from MRSA252) SA1409 (dnaK) molecular chaperone DnaK [2] (data from MRSA252) SA1029 (ftsZ) cell division protein FtsZ [2] (data from MRSA252) SA1251 (murG) undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase [2] (data from MRSA252) SA1244 (odhB) dihydrolipoamide succinyltransferase [2] (data from MRSA252) SA0943-1 (pdhA) pyruvate dehydrogenase E1 component subunit alpha [2] (data from MRSA252) SA0944 (pdhB) pyruvate dehydrogenase E1 component subunit beta [2] (data from MRSA252) SA0945 (pdhC) branched-chain alpha-keto acid dehydrogenase E2 subunit [2] (data from MRSA252) SA0946 (pdhD) dihydrolipoamide dehydrogenase [2] (data from MRSA252) SA1938 (pdp) pyrimidine-nucleoside phosphorylase [2] (data from MRSA252) SA0218 (pflB) formate acetyltransferase [2] (data from MRSA252) SA2044 (rplB) 50S ribosomal protein L2 [2] (data from MRSA252) SA2046 (rplD) 50S ribosomal protein L4 [2] (data from MRSA252) SA2029 (rplO) 50S ribosomal protein L15 [2] (data from MRSA252) SA2032 (rplR) 50S ribosomal protein L18 [2] (data from MRSA252) SA1084 (rplS) 50S ribosomal protein L19 [2] (data from MRSA252) SA1473 (rplU) 50S ribosomal protein L21 [2] (data from MRSA252) SA2042 (rplV) 50S ribosomal protein L22 [2] (data from MRSA252) SA1099 (rpsB) 30S ribosomal protein S2 [2] (data from MRSA252) SA2041 (rpsC) 30S ribosomal protein S3 [2] (data from MRSA252) SA2025 (rpsM) 30S ribosomal protein S13 [2] (data from MRSA252) SA0506 (tuf) elongation factor Tu [2] (data from MRSA252) SA0802 hypothetical protein [2] (data from MRSA252) SA1271 threonine dehydratase [2] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: rpsB > tsf > pyrH > frr
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ R Allyn Forsyth, Robert J Haselbeck, Kari L Ohlsen, Robert T Yamamoto, Howard Xu, John D Trawick, Daniel Wall, Liangsu Wang, Vickie Brown-Driver, Jamie M Froelich, Kedar G C, Paula King, Melissa McCarthy, Cheryl Malone, Brian Misiner, David Robbins, Zehui Tan, Zhan-yang Zhu Zy, Grant Carr, Deborah A Mosca, Carlos Zamudio, J Gordon Foulkes, Judith W Zyskind
A genome-wide strategy for the identification of essential genes in Staphylococcus aureus.
Mol Microbiol: 2002, 43(6);1387-400
[PubMed:11952893] [WorldCat.org] [DOI] (P p) - ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 2.19 2.20 2.21 2.22 2.23 2.24 2.25 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)
⊟Relevant publications[edit | edit source]
Alexander Scherl, Patrice François, Manuela Bento, Jacques M Deshusses, Yvan Charbonnier, Véronique Converset, Antoine Huyghe, Nadia Walter, Christine Hoogland, Ron D Appel, Jean-Charles Sanchez, Catherine G Zimmermann-Ivol, Garry L Corthals, Denis F Hochstrasser, Jacques Schrenzel
Correlation of proteomic and transcriptomic profiles of Staphylococcus aureus during the post-exponential phase of growth.
J Microbiol Methods: 2005, 60(2);247-57
[PubMed:15590099] [WorldCat.org] [DOI] (P p)