From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2544 [new locus tag: SACOL_RS13320 ]
  • pan locus tag?: SAUPAN006183000
  • symbol: sdaAA
  • pan gene symbol?: sdaAA
  • synonym:
  • product: L-serine dehydratase, iron-sulfur-dependent subunit alpha

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL2544 [new locus tag: SACOL_RS13320 ]
  • symbol: sdaAA
  • product: L-serine dehydratase, iron-sulfur-dependent subunit alpha
  • replicon: chromosome
  • strand: -
  • coordinates: 2602100..2602999
  • length: 900
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGTTTGATTCAATTAGAGAGACTATAGATTATGCCGTAGAAAATAATATGTCATTTGCG
    GATATCATGGTTAAAGAAGAAATGGAATTAAGCGGTAAATCACGTGATGAAGTGCGAGCG
    CAAATGAAACAAAATTTAGATGTCATGCGAGACGCAGTAATCAAAGGGACGACAGGTGAT
    GGGGTTGAAAGTGTAACGGGCTACACTGGTCATGATGCTGCTAAACTACGTGATTATAAT
    GAAACACATCATGCTTTGTCTGGATATGAAATGATTGACGCAGTCAAAGGTGCCATTGCA
    ACAAATGAAGTCAATGCTGCGATGGGTATTATTTGTGCAACGCCAACAGCTGGTTCCTCG
    GGTACCATTCCCGGTGCACTTTTTAAATTAGAAAAAACACATGATTTAACAGAAGAGCAA
    ATGATTGATTTCTTATTCACTTCAGCATTGTTTGGGCGTGTCGTAGCAAACAATGCAAGT
    GTAGCTGGTGCAACAGGTGGCTGCCAAGCTGAAGTTGGTTCAGCATCTGCAATGGCCGCA
    GCTGCAGCAGTAGCTATATTCGGAGGATCACCAGAAGCATCCGGGCACGCTATGGCATTA
    GCGATAAGTAATTTATTAGGTTTAGTTTGTGATCCAGTAGCCGGACTTGTTGAAATTCCT
    TGTGTTATGAGAAATGCAATTGGTTCGGGTAACGCTTTAATTTCAGCAGATTTAGCATTA
    GCAGGTATTGAAAGTAGAATCCCTGTTGATGAAGTTATTGAAGCAATGGATAAGGTTGGT
    CGTAACCTTCCTGCATCATTACGTGAAACTGGATTGGGTGGACTAGCAGGCACACCAACT
    GGCGAAGCAATTAAACGTAAAATCTTTGGCACAGCTGAAGATATGGTTAAAAATAATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL2544 [new locus tag: SACOL_RS13320 ]
  • symbol: SdaAA
  • description: L-serine dehydratase, iron-sulfur-dependent subunit alpha
  • length: 299
  • theoretical pI: 4.42838
  • theoretical MW: 30971
  • GRAVY: 0.100334

Function[edit | edit source]

  • reaction:
    EC 4.3.1.17?  ExPASy
    L-serine ammonia-lyase L-serine = pyruvate + NH3
  • TIGRFAM:
    Metabolism Energy metabolism Amino acids and amines L-serine dehydratase, iron-sulfur-dependent, alpha subunit (TIGR00718; EC 4.3.1.17; HMM-score: 374.2)
    Metabolism Energy metabolism Glycolysis/gluconeogenesis L-serine dehydratase, iron-sulfur-dependent, alpha subunit (TIGR00718; EC 4.3.1.17; HMM-score: 374.2)
    and 2 more
    Metabolism Energy metabolism Amino acids and amines L-serine ammonia-lyase (TIGR00720; EC 4.3.1.17; HMM-score: 188.9)
    Metabolism Energy metabolism Glycolysis/gluconeogenesis L-serine ammonia-lyase (TIGR00720; EC 4.3.1.17; HMM-score: 188.9)
  • TheSEED:  
    Amino Acids and Derivatives Alanine, serine, and glycine Glycine and Serine Utilization  L-serine dehydratase, alpha subunit (EC 4.3.1.17)
    and 1 more
    Carbohydrates Central carbohydrate metabolism Pyruvate Alanine Serine Interconversions  L-serine dehydratase, alpha subunit (EC 4.3.1.17)
  • PFAM:
    no clan defined SDH_alpha; Serine dehydratase alpha chain (PF03313; HMM-score: 238)
    and 1 more
    T3SS-Chaperone (CL0419) YscO-like; YscO-like protein (PF16789; HMM-score: 13)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.008833
    • TAT(Tat/SPI): 0.001752
    • LIPO(Sec/SPII): 0.00055
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MFDSIRETIDYAVENNMSFADIMVKEEMELSGKSRDEVRAQMKQNLDVMRDAVIKGTTGDGVESVTGYTGHDAAKLRDYNETHHALSGYEMIDAVKGAIATNEVNAAMGIICATPTAGSSGTIPGALFKLEKTHDLTEEQMIDFLFTSALFGRVVANNASVAGATGGCQAEVGSASAMAAAAAVAIFGGSPEASGHAMALAISNLLGLVCDPVAGLVEIPCVMRNAIGSGNALISADLALAGIESRIPVDEVIEAMDKVGRNLPASLRETGLGGLAGTPTGEAIKRKIFGTAEDMVKNN

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator: CcpA regulon
    CcpA(TF)important in Carbon catabolism; RegPrecise    transcription unit transferred from N315 data RegPrecise  

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]