Jump to navigation
Jump to search
NCBI: 03-AUG-2016
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus NCTC8325
- locus tag: SAOUHSC_01311
- pan locus tag?: SAUPAN003685000
- symbol: SAOUHSC_01311
- pan gene symbol?: —
- synonym:
- product: ABC transporter ATP-binding protein
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAOUHSC_01311
- symbol: SAOUHSC_01311
- product: ABC transporter ATP-binding protein
- replicon: chromosome
- strand: +
- coordinates: 1255614..1256522
- length: 909
- essential: no [1] DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3920137 NCBI
- RefSeq: YP_499841 NCBI
- BioCyc: G1I0R-1225 BioCyc
- MicrobesOnline: 1289755 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901GTGATTAAATTGATTCAAATATCTAATATCAACAAGTCATTTAATAAAAGATGTGTTCTA
AAAAATATTTCGTTCGATATTGAACAAGGTAAATGTATCGCTTTAATTGGAAAAAATGGT
GCTGGAAAGTCAACGTTAATTGATATATTAATTGGTAATGTTAATGCTAATTCTGGTGAG
ATATTTGATAAAGACAAGTTATTACAAAGTGAAAATCGCAGTATAATGTTCCAAAAAACG
ATGTTTCCAGATCAATTAAAAGTTATTGAGATTATCAACTTATATCAATCATTTTACGAA
AATCCATTACCATTGGAAGAAATAATAGAACTGACGAAATTTGATTCTAGTCAACTGAAC
CAATTTGTAAATAAACTTTCTGGTGGTCAACAACGATTACTCGATTTTGTATTATCTTTA
ATCGGACAACCACAATTGATCTTATTAGATGAACCAACATCGACTATGGATATAGAAATT
AGAGAATATTTTTGGTCAATTATTGAAAATTTAAAAGAAGATAATCGAACGATACTCTAT
ACATCGCACTATATTGAAGAAGTCGAACGTATGTCAGACAAAATTATTCTCATTGAAAAT
GGAGAAATAATACTTAATGATTCAACGTCACATATTAGAACCAATCAGCAATCTCAGATT
ACGTTATCCGATGAATATATAAGAAAGTTAAAACTAGATAAAGATGATTTAGTTATTCAA
AAAAATCATAATGGCACTATCAAAATTATTACTTCAAATGTAAATGATACGATTTTATAT
CTTCAACAACTTCATATTAATTTGGATGATATTGAAATACAAAAAGTCTCAATTGTTGAT
TCATACTTCAACAATAAAAAGCAAAGGGGATCTAATTATGATACTAAGTTACTTGAAAAT
CGAATTTAA60
120
180
240
300
360
420
480
540
600
660
720
780
840
900
909
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAOUHSC_01311
- symbol: SAOUHSC_01311
- description: ABC transporter ATP-binding protein
- length: 302
- theoretical pI: 4.97775
- theoretical MW: 34931.8
- GRAVY: -0.309934
⊟Function[edit | edit source]
- TIGRFAM: Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 140.8)Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 116.8)and 72 moreTransport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 112)Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 110.3)Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 110.3)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 100.7)Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 98.5)gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 98.1)lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 98.1)Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 96.5)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 96.3)Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 96.3)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 95.1)Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 94.4)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 94.1)Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 92.3)Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 91.9)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 91.9)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 91.4)Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 90.6)Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 89.1)Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 89.1)Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 85.7)Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 85.6)2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 80.4)thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 79.6)Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 77.5)Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 76.9)Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 76.6)Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 75.3)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 74.9)Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 74.2)Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 74)Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 73)Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 72.6)Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 72.6)proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 72.5)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 71.3)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 71)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 71)D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 70.8)ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 70.5)ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 69.6)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 68.1)Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 68.1)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 66.7)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 66.7)Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 66.1)Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 65.5)ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 65.1)Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 64.3)ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 63.5)Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 62.7)Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 62.7)phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 61.8)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 61.3)Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 60.9)Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 60.3)Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 60.3)Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 60.3)thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 60.1)Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 58.4)Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 57.1)Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 49.4)Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 47.9)Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 47.9)Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 45.8)Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 39.9)Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 32.8)Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 31.1)DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 19.5)DNA metabolism DNA replication, recombination, and repair exonuclease SbcC (TIGR00618; HMM-score: 18.4)Transport and binding proteins Amino acids, peptides and amines LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 11.9)Regulatory functions Protein interactions LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 11.9)
- TheSEED :
- ABC transporter, ATP-binding protein
- PFAM: P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 87)and 13 moreAAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 48)RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 23.7)AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 23.1)SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 20)AAA_22; AAA domain (PF13401; HMM-score: 17.5)MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 15.8)DUF5906; Family of unknown function (DUF5906) (PF19263; HMM-score: 14.5)TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 13.9)AAA_24; AAA domain (PF13479; HMM-score: 13.3)SbcC_Walker_B; SbcC/RAD50-like, Walker B motif (PF13558; HMM-score: 12.1)AAA_23; AAA domain (PF13476; HMM-score: 11.9)AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 11.4)MeaB; Methylmalonyl Co-A mutase-associated GTPase MeaB (PF03308; HMM-score: 11.4)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 1.05
- Cytoplasmic Membrane Score: 8.78
- Cellwall Score: 0.08
- Extracellular Score: 0.09
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.5277
- Cytoplasmic Membrane Score: 0.4616
- Cell wall & surface Score: 0.0002
- Extracellular Score: 0.0105
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.040494
- TAT(Tat/SPI): 0.000169
- LIPO(Sec/SPII): 0.000543
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MIKLIQISNINKSFNKRCVLKNISFDIEQGKCIALIGKNGAGKSTLIDILIGNVNANSGEIFDKDKLLQSENRSIMFQKTMFPDQLKVIEIINLYQSFYENPLPLEEIIELTKFDSSQLNQFVNKLSGGQQRLLDFVLSLIGQPQLILLDEPTSTMDIEIREYFWSIIENLKEDNRTILYTSHYIEEVERMSDKIILIENGEIILNDSTSHIRTNQQSQITLSDEYIRKLKLDKDDLVIQKNHNGTIKIITSNVNDTILYLQQLHINLDDIEIQKVSIVDSYFNNKKQRGSNYDTKLLENRI
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
SAOUHSC_00519 (rplA) 50S ribosomal protein L1 [2] (data from MRSA252) SAOUHSC_02492 (rplO) 50S ribosomal protein L15 [2] (data from MRSA252) SAOUHSC_02484 (rplQ) 50S ribosomal protein L17 [2] (data from MRSA252) SAOUHSC_01757 (rplU) 50S ribosomal protein L21 [2] (data from MRSA252) SAOUHSC_01232 (rpsB) 30S ribosomal protein S2 [2] (data from MRSA252) SAOUHSC_02506 (rpsC) 30S ribosomal protein S3 [2] (data from MRSA252) SAOUHSC_02494 (rpsE) 30S ribosomal protein S5 [2] (data from MRSA252) SAOUHSC_01234 (tsf) elongation factor Ts [2] (data from MRSA252) SAOUHSC_00187 formate acetyltransferase [2] (data from MRSA252) SAOUHSC_00374 inosine-5'-monophosphate dehydrogenase [2] (data from MRSA252) SAOUHSC_00488 hypothetical protein [2] (data from MRSA252) SAOUHSC_00529 elongation factor G [2] (data from MRSA252) SAOUHSC_00530 elongation factor Tu [2] (data from MRSA252) SAOUHSC_00795 glyceraldehyde-3-phosphate dehydrogenase [2] (data from MRSA252) SAOUHSC_00878 hypothetical protein [2] (data from MRSA252) SAOUHSC_01040 pyruvate dehydrogenase complex, E1 component subunit alpha [2] (data from MRSA252) SAOUHSC_01043 dihydrolipoamide dehydrogenase [2] (data from MRSA252) SAOUHSC_01100 thioredoxin [2] (data from MRSA252) SAOUHSC_01337 transketolase [2] (data from MRSA252) SAOUHSC_01490 DNA-binding protein HU [2] (data from MRSA252) SAOUHSC_01806 pyruvate kinase [2] (data from MRSA252) SAOUHSC_01819 hypothetical protein [2] (data from MRSA252) SAOUHSC_01820 acetate kinase [2] (data from MRSA252) SAOUHSC_02399 glucosamine--fructose-6-phosphate aminotransferase [2] (data from MRSA252) SAOUHSC_02441 alkaline shock protein 23 [2] (data from MRSA252) SAOUHSC_02969 arginine deiminase [2] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: [3]
Multi-gene expression profiles
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Roy R Chaudhuri, Andrew G Allen, Paul J Owen, Gil Shalom, Karl Stone, Marcus Harrison, Timothy A Burgis, Michael Lockyer, Jorge Garcia-Lara, Simon J Foster, Stephen J Pleasance, Sarah E Peters, Duncan J Maskell, Ian G Charles
Comprehensive identification of essential Staphylococcus aureus genes using Transposon-Mediated Differential Hybridisation (TMDH).
BMC Genomics: 2009, 10;291
[PubMed:19570206] [WorldCat.org] [DOI] (I e) - ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 2.19 2.20 2.21 2.22 2.23 2.24 2.25 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p) - ↑ Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
PLoS Genet: 2016, 12(4);e1005962
[PubMed:27035918] [WorldCat.org] [DOI] (I e)
