Jump to navigation
Jump to search
NCBI: 26-AUG-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA1156 [new locus tag: SA_RS06565 ]
- pan locus tag?: SAUPAN003685000
- symbol: SA1156
- pan gene symbol?: —
- synonym:
- product: hypothetical protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SA1156 [new locus tag: SA_RS06565 ]
- symbol: SA1156
- product: hypothetical protein
- replicon: chromosome
- strand: +
- coordinates: 1317694..1318593
- length: 900
- essential: no DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 1123991 NCBI
- RefSeq: NP_374433 NCBI
- BioCyc: see SA_RS06565
- MicrobesOnline: 103459 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841TTGATTCAAATATCTAATATCAACAAGTCATTTAATAAAAGATGTGTTCTAAAAAATATT
TCGTTCGATATTGAACAAGGTAAATGTATCGCTTTAATTGGAAAAAATGGTGCTGGAAAG
TCAACGTTAATTGATATATTAATTGGTAATGTTAATGCTAATTCTGGTGAGATATTTGAT
AAAGACAAGTTATTACAAAGTGAAAATCGCAGTATAATGTTCCAAAAAACGATGTTTCCA
GATCAATTAAAAGTTATTGAGATTATCAACTTATATCAATCATTTTACGAAAATCCATTA
CCATTGGAAGAAATAATAGAACTGACGAAATTTGATTCTAGTCAACTGAACCAATTTGTA
AATAAACTTTCTGGTGGTCAACAACGATTACTCGATTTTGTATTATCTTTAATCGGACAA
CCACAATTGATCTTATTAGATGAACCAACATCGACTATGGATATAGAAATTAGAGAATAT
TTTTGGTCAATTATTGAAAATTTAAAAGAAGATAATCGAACGATACTCTATACATCGCAC
TATATTGAAGAAGTCGAACGTATGTCAGACAAAATTATTCTCATTGAAAATGGAGAAATA
ATACTTAATGATTCAACGTCACATATTAGAACCAATCAGCAATCTCAGATTACGTTATCC
GATGAATATATAAGAAAGTTAAAACTAGATAAAGATGATTTAGTTATTCAAAAAAATCAT
AATGGCACTATCAAAATTATTACTTCAAATGTAAATGATACGATTTTATATCTTCAACAA
CTTCATATTAATTTGGATGATATTGAAATACAAAAAGTCTCAATTGTTGATTCATACTTC
AACAATAAAAAGCAAAGGGGATCTAATTATGATACTAAGTTACTTGAAAATCGAATTTAA60
120
180
240
300
360
420
480
540
600
660
720
780
840
900
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA1156 [new locus tag: SA_RS06565 ]
- symbol: SA1156
- description: hypothetical protein
- length: 299
- theoretical pI: 4.87376
- theoretical MW: 34577.3
- GRAVY: -0.327759
⊟Function[edit | edit source]
- TIGRFAM: Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 140.9)Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 117.3)and 72 moreTransport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 112)Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 110.2)Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 110.2)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 100.7)Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 99.3)lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 98.1)gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 97.9)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 96.4)Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 96.4)Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 95.8)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 94.7)Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 94.5)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 94.2)Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 92.3)Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 91.9)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 91.9)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 91)Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 90.1)Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 89.2)Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 89.2)Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 85.8)Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 85.6)2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 80.2)thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 79.2)Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 79)Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 76.9)Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 76.6)Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 75.3)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 74.7)Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 74)Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 73.8)Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 73)Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 72.6)Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 72.6)proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 72.6)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 71.3)D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 71)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 70.9)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 70.9)ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 69.6)ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 69.4)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 68)Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 68)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 66.7)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 66.7)Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 66.2)Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 65.3)ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 65)Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 64.3)ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 63.7)Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 62.7)Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 62.7)phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 62)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 61.3)Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 60.9)Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 60.5)Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 60.5)Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 60.5)thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 60)Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 58.4)Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 57.1)Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 49.3)Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 47.7)Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 47.7)Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 44.7)Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 39.8)Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 32.4)Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 31.1)DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 19.7)DNA metabolism DNA replication, recombination, and repair exonuclease SbcC (TIGR00618; HMM-score: 17.9)Transport and binding proteins Amino acids, peptides and amines LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 11.7)Regulatory functions Protein interactions LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 11.7)
- TheSEED :
- ABC transporter, ATP-binding protein
- PFAM: P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 87.2)and 13 moreAAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 48)RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 23.6)AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 23.1)SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 20.5)AAA_22; AAA domain (PF13401; HMM-score: 17.6)MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 15.8)DUF5906; Family of unknown function (DUF5906) (PF19263; HMM-score: 14.4)TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 13.9)AAA_24; AAA domain (PF13479; HMM-score: 13.3)AAA_23; AAA domain (PF13476; HMM-score: 12.3)SbcC_Walker_B; SbcC/RAD50-like, Walker B motif (PF13558; HMM-score: 12.2)AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 11)MeaB; Methylmalonyl Co-A mutase-associated GTPase MeaB (PF03308; HMM-score: 11)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 1.05
- Cytoplasmic Membrane Score: 8.78
- Cellwall Score: 0.08
- Extracellular Score: 0.09
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.5075
- Cytoplasmic Membrane Score: 0.4826
- Cell wall & surface Score: 0.0002
- Extracellular Score: 0.0097
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.040925
- TAT(Tat/SPI): 0.000195
- LIPO(Sec/SPII): 0.000653
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MIQISNINKSFNKRCVLKNISFDIEQGKCIALIGKNGAGKSTLIDILIGNVNANSGEIFDKDKLLQSENRSIMFQKTMFPDQLKVIEIINLYQSFYENPLPLEEIIELTKFDSSQLNQFVNKLSGGQQRLLDFVLSLIGQPQLILLDEPTSTMDIEIREYFWSIIENLKEDNRTILYTSHYIEEVERMSDKIILIENGEIILNDSTSHIRTNQQSQITLSDEYIRKLKLDKDDLVIQKNHNGTIKIITSNVNDTILYLQQLHINLDDIEIQKVSIVDSYFNNKKQRGSNYDTKLLENRI
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
SA1533 (ackA) acetate kinase [1] (data from MRSA252) SA2428 (arcA) arginine deiminase [1] (data from MRSA252) SA1984 (asp23) alkaline shock protein 23 [1] (data from MRSA252) SA0471 (cysK) hypothetical protein [1] (data from MRSA252) SA0505 (fus) elongation factor G [1] (data from MRSA252) SA0727 (gap) glyceraldehyde-3-phosphate dehydrogenase [1] (data from MRSA252) SA1959 (glmS) glucosamine--fructose-6-phosphate aminotransferase [1] (data from MRSA252) SA0375 (guaB) inositol-monophosphate dehydrogenase [1] (data from MRSA252) SA1305 (hu) DNA-binding protein II [1] (data from MRSA252) SA0943-1 (pdhA) pyruvate dehydrogenase E1 component subunit alpha [1] (data from MRSA252) SA0946 (pdhD) dihydrolipoamide dehydrogenase [1] (data from MRSA252) SA0218 (pflB) formate acetyltransferase [1] (data from MRSA252) SA1520 (pykA) pyruvate kinase [1] (data from MRSA252) SA0496 (rplA) 50S ribosomal protein L1 [1] (data from MRSA252) SA2029 (rplO) 50S ribosomal protein L15 [1] (data from MRSA252) SA2022 (rplQ) 50S ribosomal protein L17 [1] (data from MRSA252) SA1473 (rplU) 50S ribosomal protein L21 [1] (data from MRSA252) SA1099 (rpsB) 30S ribosomal protein S2 [1] (data from MRSA252) SA2041 (rpsC) 30S ribosomal protein S3 [1] (data from MRSA252) SA2031 (rpsE) 30S ribosomal protein S5 [1] (data from MRSA252) SA1177 (tkt) transketolase [1] (data from MRSA252) SA0992 (trxA) thioredoxin [1] (data from MRSA252) SA1100 (tsf) elongation factor Ts [1] (data from MRSA252) SA0506 (tuf) elongation factor Tu [1] (data from MRSA252) SA0802 hypothetical protein [1] (data from MRSA252) SA1532 hypothetical protein [1] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: SA1156 > SA1157 > SA1158 > SA1159
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)