From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_01750
  • pan locus tag?: SAUPAN004247000
  • symbol: ruvB
  • pan gene symbol?: ruvB
  • synonym:
  • product: Holliday junction DNA helicase RuvB

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_01750
  • symbol: ruvB
  • product: Holliday junction DNA helicase RuvB
  • replicon: chromosome
  • strand: -
  • coordinates: 1654804..1655808
  • length: 1005
  • essential: yes [1] DEG other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    ATGAATGAGCGTATGGTTGATCAATCAATGCATAGTGAAGAAACTGATTTCGAATTGTCG
    CTTAGACCTACGAGATTACGACAATATATTGGTCAAAATTCAATAAAAAGTAATTTAGAA
    GTATTTATTAAAGCGGCTAAACTTCGTCATGAACCATTAGATCATGTATTGCTTTTTGGC
    CCCCCTGGATTAGGTAAGACAACATTATCTAATATCATTGCCAATGAAATGGAAGTTAAT
    ATACGTACAGTATCAGGGCCTTCATTAGAAAGACCTGGTGATTTGGCTGCAATTTTATCA
    GGACTTCAACCTGGAGATGTTTTGTTTATTGATGAAATACACAGACTGAGTAGTGTTGTT
    GAAGAAGTGTTATACCCTGCAATGGAAGATTTCTTTTTAGATATTATCATTGGTAAAGGC
    GATGAGGCTAGAAGTATCCGTATCGACTTACCTCCATTCACTTTGGTAGGTGCAACAACG
    CGAGCTGGCAGCTTAACAGGTCCACTAAGGGATCGATTTGGTGTGCACTTAAGATTAGAA
    TATTATAACGAATCAGATTTAAAAGAAATCATTATTAGAACAGCTGAGGTTTTAGGCACA
    GGTATTGATGAAGAAAGTGCCATTGAACTTGCTAAACGTTCTAGAGGGACTCCAAGAGTA
    GCAAATCGACTATTGAAGCGGGTAAGAGACTTCCAGCAAGTGAATGAAGATGAACAAATA
    TACATTGAAACAACGAAGCACGCATTAGGTTTACTTCAAGTTGATCAACACGGACTAGAT
    TACATTGATCATAAAATGATGAACTGTATTATTAAGCAGTATAATGGCGGACCTGTTGGT
    TTAGATACGATTGCCGTAACAATTGGTGAAGAACGTATTACAATTGAGGACGTTTATGAG
    CCATTTCTTATTCAGAAAGGCTTTTTAGAACGTACGCCACGTGGCAGAAAAGCAACACCA
    TTAGCTTATGAACATTTTGCAAAGTCGAATGAGGAGAGAGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1005

⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SAOUHSC_01750
  • symbol: RuvB
  • description: Holliday junction DNA helicase RuvB
  • length: 334
  • theoretical pI: 5.0869
  • theoretical MW: 37717.7
  • GRAVY: -0.323054

⊟Function[edit | edit source]

  • reaction:
    EC 3.1.22.4?  ExPASy
    Crossover junction endodeoxyribonuclease Endonucleolytic cleavage at a junction such as a reciprocal single-stranded crossover between two homologous DNA duplexes (Holliday junction)
    EC 3.6.4.12?  ExPASy
    DNA helicase ATP + H2O = ADP + phosphate
  • TIGRFAM:
    Genetic information processing DNA metabolism DNA replication, recombination, and repair Holliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 467)
    and 26 more
    Genetic information processing DNA metabolism DNA replication, recombination, and repair DNA polymerase III, subunit gamma and tau (TIGR02397; EC 2.7.7.7; HMM-score: 32.4)
    Cellular processes Cellular processes Sporulation and germination ATP-dependent protease, Lon family (TIGR02903; EC 3.4.21.-; HMM-score: 31.2)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides ATP-dependent protease, Lon family (TIGR02903; EC 3.4.21.-; HMM-score: 31.2)
    Cellular processes Cellular processes Sporulation and germination ATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 29.3)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides ATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 29.3)
    AAA family ATPase, CDC48 subfamily (TIGR01243; HMM-score: 26.7)
    26S proteasome subunit P45 family (TIGR01242; HMM-score: 20.6)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair orc1/cdc6 family replication initiation protein (TIGR02928; HMM-score: 19)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type VII secretion AAA-ATPase EccA (TIGR03922; HMM-score: 18.7)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair DnaA regulatory inactivator Hda (TIGR03420; HMM-score: 18.4)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair chromosomal replication initiator protein DnaA (TIGR00362; HMM-score: 17.8)
    Cellular processes Cellular processes Cell division ATP-dependent metallopeptidase HflB (TIGR01241; EC 3.4.24.-; HMM-score: 17.2)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides ATP-dependent metallopeptidase HflB (TIGR01241; EC 3.4.24.-; HMM-score: 17.2)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides putative ATP-dependent protease (TIGR00764; HMM-score: 16.2)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions adenylate kinase (TIGR01351; EC 2.7.4.-; HMM-score: 15.4)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides ATP-dependent Clp protease ATP-binding subunit ClpA (TIGR02639; HMM-score: 14.7)
    Unknown function General Mg chelatase-like protein (TIGR00368; HMM-score: 14)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides endopeptidase La (TIGR00763; EC 3.4.21.53; HMM-score: 13.4)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides proteasome ATPase (TIGR03689; EC 3.6.4.8; HMM-score: 13.2)
    Cellular processes Cellular processes Sporulation and germination stage V sporulation protein K (TIGR02881; HMM-score: 13.1)
    type IV secretion/conjugal transfer ATPase, VirB4 family (TIGR00929; HMM-score: 12)
    Cellular processes Cellular processes Other gas vesicle protein GvpN (TIGR02640; HMM-score: 11.5)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair checkpoint protein rad24 (TIGR00602; HMM-score: 11.2)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides ATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 11.1)
    Genetic information processing Protein fate Protein folding and stabilization ATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 11.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll magnesium chelatase ATPase subunit I (TIGR02030; EC 6.6.1.1; HMM-score: 11.1)
  • TheSEED  :
    • Holliday junction ATP-dependent DNA helicase RuvB (EC 3.6.4.12)
    DNA Metabolism DNA recombination RuvABC plus a hypothetical  Holliday junction DNA helicase RuvB
    and 1 more
    DNA Metabolism DNA replication DNA-replication  Holliday junction DNA helicase RuvB
  • PFAM:
    P-loop_NTPase (CL0023) RuvB_N; Holliday junction DNA helicase ruvB N-terminus (PF05496; HMM-score: 379.7)
    and 24 more
    HTH (CL0123) RuvB_C; Holliday junction DNA helicase ruvB C-terminus (PF05491; HMM-score: 115)
    P-loop_NTPase (CL0023) AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 67.3)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 31.4)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 22.3)
    AAA_22; AAA domain (PF13401; HMM-score: 19.6)
    DUF815; Protein of unknown function (DUF815) (PF05673; HMM-score: 19.1)
    AAA_3; ATPase family associated with various cellular activities (AAA) (PF07726; HMM-score: 18.7)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 17.4)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 17.2)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 16.9)
    AAA_18; AAA domain (PF13238; HMM-score: 16.6)
    Sigma54_activat; Sigma-54 interaction domain (PF00158; HMM-score: 16.4)
    TIP49; TIP49 C-terminus (PF06068; HMM-score: 16.4)
    AAA_14; AAA domain (PF13173; HMM-score: 16.4)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 16.3)
    NTPase_1; NTPase (PF03266; HMM-score: 14.6)
    AAA_28; AAA domain (PF13521; HMM-score: 14.6)
    ABC_tran; ABC transporter (PF00005; HMM-score: 14.5)
    Sigma54_activ_2; Sigma-54 interaction domain (PF14532; HMM-score: 14.4)
    AAA_19; AAA domain (PF13245; HMM-score: 14.1)
    Bac_DnaA; Bacterial dnaA protein (PF00308; HMM-score: 12.6)
    NB-ARC; NB-ARC domain (PF00931; HMM-score: 12.2)
    T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 11.6)
    Rad17; Rad17 cell cycle checkpoint protein (PF03215; HMM-score: 11.4)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.003423
    • TAT(Tat/SPI): 0.000889
    • LIPO(Sec/SPII): 0.000392
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MNERMVDQSMHSEETDFELSLRPTRLRQYIGQNSIKSNLEVFIKAAKLRHEPLDHVLLFGPPGLGKTTLSNIIANEMEVNIRTVSGPSLERPGDLAAILSGLQPGDVLFIDEIHRLSSVVEEVLYPAMEDFFLDIIIGKGDEARSIRIDLPPFTLVGATTRAGSLTGPLRDRFGVHLRLEYYNESDLKEIIIRTAEVLGTGIDEESAIELAKRSRGTPRVANRLLKRVRDFQQVNEDEQIYIETTKHALGLLQVDQHGLDYIDHKMMNCIIKQYNGGPVGLDTIAVTIGEERITIEDVYEPFLIQKGFLERTPRGRKATPLAYEHFAKSNEERE

⊟Experimental data[edit | edit source]

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator:

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Roy R Chaudhuri, Andrew G Allen, Paul J Owen, Gil Shalom, Karl Stone, Marcus Harrison, Timothy A Burgis, Michael Lockyer, Jorge Garcia-Lara, Simon J Foster, Stephen J Pleasance, Sarah E Peters, Duncan J Maskell, Ian G Charles
    Comprehensive identification of essential Staphylococcus aureus genes using Transposon-Mediated Differential Hybridisation (TMDH).
    BMC Genomics: 2009, 10;291
    [PubMed:19570206] [WorldCat.org] [DOI] (I e)
  2. ↑ Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  3. ↑ Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  4. ↑ 4.00 4.01 4.02 4.03 4.04 4.05 4.06 4.07 4.08 4.09 4.10 4.11 4.12 4.13 4.14 4.15 4.16 4.17 4.18 4.19 4.20 4.21 4.22 4.23 4.24 4.25 4.26 4.27 4.28 4.29 4.30 4.31 4.32 4.33 4.34 4.35 4.36 4.37 4.38 4.39 4.40 4.41 4.42 4.43 4.44 4.45 4.46 4.47 4.48 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  5. ↑ 5.0 5.1 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

⊟Relevant publications[edit | edit source]

Retrieved from "http://aureowiki.med.uni-greifswald.de/index.php?title=SAOUHSC_01750&oldid=95000"