From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_1579 [new locus tag: SAUSA300_RS08605 ]
  • pan locus tag?: SAUPAN004223000
  • symbol: SAUSA300_1579
  • pan gene symbol?: iscS
  • synonym:
  • product: aminotransferase, class V

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_1579 [new locus tag: SAUSA300_RS08605 ]
  • symbol: SAUSA300_1579
  • product: aminotransferase, class V
  • replicon: chromosome
  • strand: -
  • coordinates: 1729757..1730899
  • length: 1143
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    ATGGAAATTTATGCAGATTATGCTGCGACCACACCAGTAAAACCTGAAGTAGTAGATGCG
    ATGATGACGATTTACAATTCGCATTATGGTAATCCATCATCAATACATGCTAAGGGAAGA
    GATGCGCGTAAATATTTAGATGAGTCAAGACGTCAAATTGCACAATTACTTGGTGCAGAT
    ACACATGAAATTATATTTACGAGTGGCGCAACAGAATCGAATAATACGGCAATTAAAGGC
    ATAGTAAAAGCAAATGAACAATTGGGTAATCACATTATCACATCGAAGATTGAACATCAT
    TCTGTGTTACATGTTTTTGAACAATTAGAGCGAGAAGGTTTTGATGTAACATATCTAGAT
    GTTGATGATACAGGTGCTATTGATTTAGATCAACTTGAAGAAACAATTACAGATAAGACG
    ATTTTAGTATCTATTATGTTTGTAAATAATGAAGTTGGCACAGTGCAACAAATTTATGAT
    ATTCAAGATATTATTGCTGAGACAAATGCATATTTCCATGTTGATGCGGTTCAAGCAATT
    GGACATCTTGATGTTAAGTTTGACGAATTTGAGATCGACGCAATGAGTATTACTGCTCAT
    AAGTTTGGCGGACCAAAAGGTGTCGGTGCATTACTAGTTAAAGACCATGTTACACTAGAT
    TATCCTCAACTTGGCGGTGAACAAGAATTGAAACGCCGTGCAGGCACTGAAAATCTTGCG
    CAAATTGTTGGGATGGCTAAAGCATTACAATTAGCAGAAAAGAATCGAGACGATAACAAT
    ATTCATTTAATGAATTTAAAAGAACAATTTTTAGTTAAATTACAAGAAAGAGCGATTCCA
    TTTGAATTAAATGGTTCAATGACGGATGCTACAGGCCATATTGTAAATCTATATTTTCCG
    TTTGTTGAAGTTGAAACGATGTTAACATTGTTGGATATGGCACAAATCTATGTGTCGTCT
    GGATCTGCATGTACAGCAGGCTCTACACAACCGTCGCATGTTTTAGATGCAATGTTCGAA
    GATGAGGAGCGATCAAATCATTCGATTCGATTTAGTTTTAACGAATTGACTACTGAAAAT
    GAAATTAATGCAATTGTAGCTGAAATTCATAAAATATATTTTAAATTTAAGGAGGAGTCA
    TAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1143

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_1579 [new locus tag: SAUSA300_RS08605 ]
  • symbol: SAUSA300_1579
  • description: aminotransferase, class V
  • length: 380
  • theoretical pI: 4.53326
  • theoretical MW: 42484.5
  • GRAVY: -0.236579

Function[edit | edit source]

  • TIGRFAM:
    cysteine desulfurase NifS (TIGR03402; EC 2.8.1.7; HMM-score: 431.5)
    Genetic information processing Protein synthesis tRNA and rRNA base modification cysteine desulfurase IscS (TIGR02006; EC 2.8.1.7; HMM-score: 378.7)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other cysteine desulfurase IscS (TIGR02006; EC 2.8.1.7; HMM-score: 378.7)
    Genetic information processing DNA metabolism Restriction/modification cysteine desulfurase DndA (TIGR03235; EC 2.8.1.7; HMM-score: 370.2)
    and 17 more
    cysteine desulfurase, NifS family (TIGR03403; EC 2.8.1.7; HMM-score: 270.5)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other cysteine desulfurase, SufS family (TIGR01979; HMM-score: 175.1)
    Unknown function Enzymes of unknown specificity cysteine desulfurase family protein (TIGR01977; HMM-score: 157.2)
    Unknown function Enzymes of unknown specificity cysteine desulfurase family protein (TIGR01976; HMM-score: 98)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other cysteine desulfurase, catalytic subunit CsdA (TIGR03392; EC 2.8.1.7; HMM-score: 97.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Glutathione and analogs ergothioneine biosynthesis PLP-dependent enzyme EgtE (TIGR04343; EC 4.4.-.-; HMM-score: 69.6)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other tyrosine decarboxylase MnfA (TIGR03812; EC 4.1.1.25; HMM-score: 51.1)
    2-aminoethylphosphonate aminotransferase (TIGR03301; EC 2.6.1.-; HMM-score: 35.6)
    Cellular processes Cellular processes Biosynthesis of natural products capreomycidine synthase (TIGR03947; HMM-score: 23.8)
    tyrosine/nicotianamine family aminotransferase (TIGR01265; HMM-score: 22.6)
    O-phospho-L-seryl-tRNA:Cys-tRNA synthase (TIGR02539; EC 2.5.1.73; HMM-score: 19.6)
    Metabolism Energy metabolism Amino acids and amines tyrosine aminotransferase (TIGR01264; EC 2.6.1.5; HMM-score: 18.2)
    Metabolism Central intermediary metabolism Phosphorus compounds 2-aminoethylphosphonate--pyruvate transaminase (TIGR02326; EC 2.6.1.37; HMM-score: 17.3)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pantothenate and coenzyme A putative pyridoxal-dependent aspartate 1-decarboxylase (TIGR03799; EC 4.1.1.-; HMM-score: 16.8)
    dTDP-4-dehydro-6-deoxyglucose aminotransferase (TIGR04427; EC 2.-.-.-; HMM-score: 16.8)
    Metabolism Amino acid biosynthesis Histidine family histidinol-phosphate transaminase (TIGR01141; EC 2.6.1.9; HMM-score: 14.9)
    putative C-S lyase (TIGR04350; EC 4.4.-.-; HMM-score: 11.6)
  • TheSEED:  
    Amino Acids and Derivatives Alanine, serine, and glycine Alanine biosynthesis  Cysteine desulfurase (EC 2.8.1.7)
    and 5 more
    Clustering-based subsystems Cell Division CBSS-393130.3.peg.794  Cysteine desulfurase (EC 2.8.1.7)
    Lysine, threonine, methionine, and cysteine CBSS-84588.1.peg.1247  Cysteine desulfurase (EC 2.8.1.7)
    RNA Metabolism RNA processing and modification tRNA modification Archaea  Cysteine desulfurase (EC 2.8.1.7)
    tRNA mods Archaea  Cysteine desulfurase (EC 2.8.1.7)
    Sulfur Metabolism Organic sulfur assimilation At5g37530 (CsdL protein family)  Cysteine desulfurase (EC 2.8.1.7)
  • PFAM:
    PLP_aminotran (CL0061) Aminotran_5; Aminotransferase class-V (PF00266; HMM-score: 266.7)
    and 5 more
    DegT_DnrJ_EryC1; DegT/DnrJ/EryC1/StrS aminotransferase family (PF01041; HMM-score: 31.7)
    Cys_Met_Meta_PP; Cys/Met metabolism PLP-dependent enzyme (PF01053; HMM-score: 18.1)
    Pyridoxal_deC; Pyridoxal-dependent decarboxylase conserved domain (PF00282; HMM-score: 18)
    Beta_elim_lyase; Beta-eliminating lyase (PF01212; HMM-score: 16.3)
    no clan defined HR1; Hr1 repeat (PF02185; HMM-score: 10.4)

Structure, modifications & interactions[edit | edit source]

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.015025
    • TAT(Tat/SPI): 0.000373
    • LIPO(Sec/SPII): 0.001151
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MEIYADYAATTPVKPEVVDAMMTIYNSHYGNPSSIHAKGRDARKYLDESRRQIAQLLGADTHEIIFTSGATESNNTAIKGIVKANEQLGNHIITSKIEHHSVLHVFEQLEREGFDVTYLDVDDTGAIDLDQLEETITDKTILVSIMFVNNEVGTVQQIYDIQDIIAETNAYFHVDAVQAIGHLDVKFDEFEIDAMSITAHKFGGPKGVGALLVKDHVTLDYPQLGGEQELKRRAGTENLAQIVGMAKALQLAEKNRDDNNIHLMNLKEQFLVKLQERAIPFELNGSMTDATGHIVNLYFPFVEVETMLTLLDMAQIYVSSGSACTAGSTQPSHVLDAMFEDEERSNHSIRFSFNELTTENEINAIVAEIHKIYFKFKEES

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]