From AureoWiki
Jump to navigation Jump to search
Pangenome04-0298108BA0217611819-97685071193COLECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50N315NCTC8325NewmanRF122ST398T0131TCH60TW20USA300_FPR3757USA300_TCH1516VC40

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS00310 [old locus tag: SA0033 ]
  • pan locus tag?: SAUPAN000092000
  • symbol: SA_RS00310
  • pan gene symbol?: aadD
  • synonym:
  • product: aminoglycoside O-nucleotidyltransferase ANT(4')-Ia

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA_RS00310 [old locus tag: SA0033 ]
  • symbol: SA_RS00310
  • product: aminoglycoside O-nucleotidyltransferase ANT(4')-Ia
  • replicon: chromosome
  • strand: -
  • coordinates: 40818..41588
  • length: 771
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_002745 (40818..41588) NCBI
  • BioCyc: G1G21-35 BioCyc
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGAGAATAGTGAATGGACCAATAATAATGACTAGAGAAGAAAGAATGAAGATTGTTCAT
    GAAATTAAGGAACGAATATTGGATAAATATGGGGATGATGTTAAGGCTATTGGTGTTTAT
    GGCTCTCTTGGTCGTCAGACTGATGGGCCCTATTCGGATATTGAGATGATGTGTGTCATG
    TCAACAGAGGAAGCAGAGTTCAGCCATGAATGGACAACCGGTGAGTGGAAGGTGGAAGTG
    AATTTTGATAGCGAAGAGATTCTACTAGATTATGCATCTCAGGTGGAATCAGATTGGCCG
    CTTACACATGGTCAATTTTTCTCTATTTTGCCGATTTATGATTCAGGTGGATACTTAGAG
    AAAGTGTATCAAACTGCTAAATCGGTAGAAGCCCAAACGTTCCACGATGCGATTTGTGCC
    CTTATCGTAGAAGAGCTGTTTGAATATGCAGGCAAATGGCGTAATATTCGTGTGCAAGGA
    CCGACAACATTTCTACCATCCTTGACTGTACAGGTAGCAATGGCAGGTGCCATGTTGATT
    GGTCTGCATCATCGCATCTGTTATACGACGAGCGCTTCGGTCTTAACTGAAGCAGTTAAG
    CAATCAGATCTTCCTTCAGGTTATGACCATCTGTGCCAGTTCGTAATGTCTGGTCAACTT
    TCCGACTCTGAGAAACTTCTGGAATCGCTAGAGAATTTCTGGAATGGGATTCAGGAGTGG
    ACAGAACGACACGGATATATAGTGGATGTGTCAAAACGCATACCATTTTGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    771

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA_RS00310 [old locus tag: SA0033 ]
  • symbol: SA_RS00310
  • description: aminoglycoside O-nucleotidyltransferase ANT(4')-Ia
  • length: 256
  • theoretical pI: 4.49776
  • theoretical MW: 29165.9
  • GRAVY: -0.204688

Function[edit | edit source]

  • TIGRFAM:
  • TheSEED:
  • PFAM:
    KNTase_C (CL0291) KNTase_C; KNTase C-terminal domain (PF07827; HMM-score: 121.8)
    and 1 more
    NTP_transf (CL0260) NTP_transf_2; Nucleotidyltransferase domain (PF01909; HMM-score: 15.3)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA_RS11130(deoA)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    SA_RS09855(gatA)glutamyl-tRNA(Gln) amidotransferase subunit A  [1] (data from MRSA252)
    SA_RS00335PBP2a family beta-lactam-resistant peptidoglycan transpeptidase MecA  [1] (data from MRSA252)
    SA_RS01275formate acetyltransferase  [1] (data from MRSA252)
    SA_RS01365L-lactate dehydrogenase  [1] (data from MRSA252)
    SA_RS02415hypothetical protein  [1] (data from MRSA252)
    SA_RS0290550S ribosomal protein L11  [1] (data from MRSA252)
    SA_RS0292050S ribosomal protein L7/L12  [1] (data from MRSA252)
    SA_RS02955elongation factor G  [1] (data from MRSA252)
    SA_RS02960elongation factor Tu  [1] (data from MRSA252)
    SA_RS04575NADH dehydrogenase  [1] (data from MRSA252)
    SA_RS05350pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SA_RS0622530S ribosomal protein S2  [1] (data from MRSA252)
    SA_RS07205serine/threonine dehydratase  [1] (data from MRSA252)
    SA_RS07920hypothetical protein  [1] (data from MRSA252)
    SA_RS08545isocitrate dehydrogenase (NADP(+))  [1] (data from MRSA252)
    SA_RS08560pyruvate kinase  [1] (data from MRSA252)
    SA_RS08600universal stress protein  [1] (data from MRSA252)
    SA_RS08625universal stress protein UspA  [1] (data from MRSA252)
    SA_RS11060aldehyde dehydrogenase family protein  [1] (data from MRSA252)
    SA_RS11430Asp23/Gls24 family envelope stress response protein  [1] (data from MRSA252)
    SA_RS1160030S ribosomal protein S9  [1] (data from MRSA252)
    SA_RS1168030S ribosomal protein S5  [1] (data from MRSA252)
    SA_RS1170550S ribosomal protein L5  [1] (data from MRSA252)
    SA_RS1172030S ribosomal protein S17  [1] (data from MRSA252)
    SA_RS1173530S ribosomal protein S3  [1] (data from MRSA252)
    SA_RS1176050S ribosomal protein L4  [1] (data from MRSA252)
    SA_RS1177030S ribosomal protein S10  [1] (data from MRSA252)
    SA_RS13915ornithine carbamoyltransferase  [1] (data from MRSA252)

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.004055
    • TAT(Tat/SPI): 0.000367
    • LIPO(Sec/SPII): 0.000683
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 487710896 NCBI
  • RefSeq: WP_001795128 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MRIVNGPIIMTREERMKIVHEIKERILDKYGDDVKAIGVYGSLGRQTDGPYSDIEMMCVMSTEEAEFSHEWTTGEWKVEVNFDSEEILLDYASQVESDWPLTHGQFFSILPIYDSGGYLEKVYQTAKSVEAQTFHDAICALIVEELFEYAGKWRNIRVQGPTTFLPSLTVQVAMAGAMLIGLHHRICYTTSASVLTEAVKQSDLPSGYDHLCQFVMSGQLSDSEKLLESLENFWNGIQEWTERHGYIVDVSKRIPF

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]