From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0897 [new locus tag: SA_RS05090 ]
  • pan locus tag?: SAUPAN003247000
  • symbol: SA0897
  • pan gene symbol?: menH
  • synonym:
  • product: hypothetical protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA0897 [new locus tag: SA_RS05090 ]
  • symbol: SA0897
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1018162..1018965
  • length: 804
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGACACATTATAAATACTATGAAGCAAACGTTGAGACCAATCAAGTTTTAGTATTACTG
    CATGGTTTTCTTAGCGACAGTCGTACTTATTATAATCACATCGATAAATATACTGATATC
    TGTCATGTCATCACTATAGACTTACCAGGCCATGGCGAAGATCAGTCTTCAATGGATGAA
    ACGTGGAATTTTGATTATATTACGACGTTGTTAGACCGAATTTTAGATAAATATAAAGAT
    AAATCAATAACATTGTTTGGATATTCAATGGGTGGGCGTGTTGCATTATATTATGCAATT
    AATGGTCACATCCCTATATCTAATTTGATATTAGAAAGTACGTCACCAGGTATTAAAGAA
    GAAGCAAATCAATTGGAACGCCGTCTTGTTGATGATGCACGTGCTAAAGTATTAGACATA
    GCAGGTATTGAATTATTTGTTAATGATTGGGAAAAGTTGCCATTATTTCAATCGCAACTA
    GAATTACCAGTTGAAATACAACATCAAATAAGACTACAACGATTGTCTCAATCGCCACAG
    AAAATGGCCAAAGCATTAAGAGATTATGGTACAGGTCAAATGCCAAACTTATGGCCGCGC
    CTGAAAGAAATTAAAGTACCAACATTAATATTAGCTGGAGAATATGATGAAAAATTTGTA
    CAGATTGCGAAAAAAATGGCAAATTTAATTCCTAATAGTAAATGTAAATTAATTTCTGCT
    ACAGGTCATACAATTCATGTGGAAGATAGTGATGAATTTGATACAATGATATTAGGATTT
    TTAAAGGAGGAGCAAAATGACTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    804

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA0897 [new locus tag: SA_RS05090 ]
  • symbol: SA0897
  • description: hypothetical protein
  • length: 267
  • theoretical pI: 5.19114
  • theoretical MW: 30709.8
  • GRAVY: -0.359176

Function[edit source | edit]

  • reaction:
    EC 4.2.99.20?  ExPASy
    2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase5-enolpyruvoyl-6-hydroxy-2-succinylcyclohex-3-ene-1-carboxylate = (1R,6R)-6-hydroxy-2-succinylcyclohexa-2,4-diene-1-carboxylate + pyruvate
  • TIGRFAM:
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersMenaquinone and ubiquinone2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase (TIGR03695; EC 4.2.99.20; HMM-score: 291.1)
    proline-specific peptidase (TIGR01250; HMM-score: 78.5)
    MetabolismEnergy metabolismOther3-oxoadipate enol-lactonase (TIGR02427; EC 3.1.1.24; HMM-score: 74.3)
    MetabolismEnergy metabolismPhotosynthesisputative magnesium chelatase accessory protein (TIGR03056; HMM-score: 57.5)
    pyrimidine utilization protein D (TIGR03611; HMM-score: 51.7)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersBiotinpimelyl-[acyl-carrier protein] methyl ester esterase (TIGR01738; EC 3.1.1.85; HMM-score: 51.5)
    2-hydroxy-6-oxo-6-phenylhexa-2,4-dienoate hydrolase (TIGR03343; EC 3.7.1.-; HMM-score: 38.9)
    MetabolismEnergy metabolismOtherpoly(3-hydroxyalkanoate) depolymerase (TIGR02240; EC 3.1.1.-; HMM-score: 37)
    MetabolismFatty acid and phospholipid metabolismBiosynthesispoly(R)-hydroxyalkanoic acid synthase, class III, PhaC subunit (TIGR01836; HMM-score: 21.3)
    MetabolismAmino acid biosynthesisAspartate familyhomoserine O-acetyltransferase (TIGR01392; EC 2.3.1.31; HMM-score: 19.5)
  • TheSEED:  
    Cofactors, Vitamins, Prosthetic Groups, PigmentsQuinone cofactorsMenaquinone and Phylloquinone Biosynthesis 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase (EC 4.2.99.20) 
    Quinone cofactorsMenaquinone biosynthesis from chorismate via 1,4-dihydroxy-2-naphthoate 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase (EC 4.2.99.20) 
  • PFAM:
    AB_hydrolase (CL0028) Abhydrolase_1; alpha/beta hydrolase fold (PF00561; HMM-score: 93.4)
    Abhydrolase_6; Alpha/beta hydrolase family (PF12697; HMM-score: 64.4)
    Hydrolase_4; Serine aminopeptidase, S33 (PF12146; HMM-score: 50.7)
    Thioesterase; Thioesterase domain (PF00975; HMM-score: 25.9)
    Cystatin (CL0121) Staphopain_pro; Staphopain proregion (PF14731; HMM-score: 23.3)
    AB_hydrolase (CL0028) Lipase_3; Lipase (class 3) (PF01764; HMM-score: 19.5)
    DUF2974; Protein of unknown function (DUF2974) (PF11187; HMM-score: 19.2)
    Ndr; Ndr family (PF03096; HMM-score: 18.4)
    PGAP1; PGAP1-like protein (PF07819; HMM-score: 18.3)
    Esterase; Putative esterase (PF00756; HMM-score: 17.6)
    Abhydrolase_2; Phospholipase/Carboxylesterase (PF02230; HMM-score: 16.3)
    DLH; Dienelactone hydrolase family (PF01738; HMM-score: 16.1)
    DUF915; Alpha/beta hydrolase of unknown function (DUF915) (PF06028; HMM-score: 14.1)
    BAAT_C; BAAT / Acyl-CoA thioester hydrolase C terminal (PF08840; HMM-score: 12.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.107
    • Ymax_pos: 11
    • Cmax: 0.118
    • Cmax_pos: 60
    • Smax: 0.162
    • Smax_pos: 2
    • Smean: 0.113
    • D: 0.109
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MTHYKYYEANVETNQVLVLLHGFLSDSRTYYNHIDKYTDICHVITIDLPGHGEDQSSMDETWNFDYITTLLDRILDKYKDKSITLFGYSMGGRVALYYAINGHIPISNLILESTSPGIKEEANQLERRLVDDARAKVLDIAGIELFVNDWEKLPLFQSQLELPVEIQHQIRLQRLSQSPQKMAKALRDYGTGQMPNLWPRLKEIKVPTLILAGEYDEKFVQIAKKMANLIPNSKCKLISATGHTIHVEDSDEFDTMILGFLKEEQND

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

Relevant publications[edit source | edit]