From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0926 [new locus tag: SA_RS05245 ]
  • pan locus tag?: SAUPAN003287000
  • symbol: purD
  • pan gene symbol?: purD
  • synonym:
  • product: phosphoribosylamine--glycine ligase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA0926 [new locus tag: SA_RS05245 ]
  • symbol: purD
  • product: phosphoribosylamine--glycine ligase
  • replicon: chromosome
  • strand: +
  • coordinates: 1051699..1052838
  • length: 1140
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    ATGACACCTATAGCTGAAGTACACACTGAAATTTCAGAATCTAATCATCAAGGGATACTA
    GATTTTGCTAAACAGCAAAATGTTGATTGGGTAGTTATAGGTCCAGAACAGCCGCTAATT
    GATGGATTAGCAGACATTTTACGAGCGAATGGTTTCAAAGTGTTTGGTCCAAATAAGCAA
    GCAGCTCAAATCGAAGGCTCAAAATTATTTGCTAAAAAGATAATGAAAAAATATAATATT
    CCAACTGCTGATTATAAAGAAGTTGAGCGAAAAAAGGATGCTTTAACATATATTGAAAAC
    TGTGAATTGCCCGTTGTTGTCAAGAAAGATGGGTTAGCTGCTGGGAAAGGCGTTATTATT
    GCAGATACTATTGAAGCAGCCAGAAGTGCTATTGAGATTATGTATGGTGATGAAGAAGAA
    GGTACTGTTGTATTTGAAACGTTTTTAGAAGGTGAAGAGTTCTCGCTAATGACATTTGTT
    AATGGTGATTTAGCAGTACCTTTCGACTGTATTGCACAAGATCATAAACGCGCATTTGAT
    CATGATGAAGGACCAAATACTGGTGGTATGGGGGCTTATTGTCCAGTACCACATATTAGT
    GACGATGTTTTAAAACTTACAAATGAAACAATTGCACAACCCATTGCAAAGGCAATGCTT
    AATGAAGGTTATCAATTCTTCGGTGTATTATACATTGGTGCTATTTTAACTAAAGATGGT
    CCAAAAGTAATAGAATTTAATGCCCGTTTTGGTGATCCTGAAGCTCAAGTATTATTAAGT
    CGCATGGAAAGTGATTTAATGCAGCATATTATTGATTTAGATGAAGGAAAACGTACTGAA
    TTCAAATGGAAAAATGAATCTATTGTAGGGGTCATGTTGGCATCAAAAGGATATCCTGAT
    GCATATGAAAAAGGGCATAAAGTAAGTGGCTTTGATTTAAATGAAAACTATTTTGTTAGT
    GGATTAAAGAAGCAAGGTGATACCTTTGTTACTTCAGGTGGTAGAGTTATACTTGCCATC
    GGAAAAGGTGACAATGTACAAGATGCACAGCGAGACGCATACGAAAAAGTATCTCAAATA
    CAAAGTGACCATTTATTCTATCGTCATGACATTGCGAATAAAGCACTACAACTTAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA0926 [new locus tag: SA_RS05245 ]
  • symbol: PurD
  • description: phosphoribosylamine--glycine ligase
  • length: 379
  • theoretical pI: 4.74913
  • theoretical MW: 41972.3
  • GRAVY: -0.291029

Function[edit source | edit]

  • reaction:
    EC 6.3.4.13?  ExPASy
    Phosphoribosylamine--glycine ligaseATP + 5-phospho-D-ribosylamine + glycine = ADP + phosphate + N1-(5-phospho-D-ribosyl)glycinamide
  • TIGRFAM:
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesPurine ribonucleotide biosynthesisphosphoribosylamine--glycine ligase (TIGR00877; EC 6.3.4.13; HMM-score: 417.3)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesPyrimidine ribonucleotide biosynthesiscarbamoyl-phosphate synthase, large subunit (TIGR01369; EC 6.3.5.5; HMM-score: 36)
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanD-alanine--D-alanine ligase (TIGR01205; EC 6.3.2.4; HMM-score: 29.2)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesPurine ribonucleotide biosynthesisphosphoribosylaminoimidazole carboxylase, ATPase subunit (TIGR01161; EC 4.1.1.21; HMM-score: 26.2)
    Cellular processesCellular processesBiosynthesis of natural productscyanophycin synthetase (TIGR02068; EC 6.3.2.29,6.3.2.30; HMM-score: 25.2)
    MetabolismFatty acid and phospholipid metabolismBiosynthesisacetyl-CoA carboxylase, biotin carboxylase subunit (TIGR00514; EC 6.3.4.14; HMM-score: 24.7)
    alpha-L-glutamate ligase, RimK family (TIGR00768; EC 6.3.2.-; HMM-score: 22)
    MetabolismEnergy metabolismTCA cyclesuccinate-CoA ligase, beta subunit (TIGR01016; EC 6.2.1.-; HMM-score: 15.1)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesPurine ribonucleotide biosynthesisphosphoribosylglycinamide formyltransferase 2 (TIGR01142; EC 2.1.2.-; HMM-score: 14.6)
    MetabolismAmino acid biosynthesisOtherpyrrolysine biosynthesis protein PylC (TIGR03909; HMM-score: 14.1)
    MetabolismEnergy metabolismGlycolysis/gluconeogenesispyruvate carboxylase (TIGR01235; EC 6.4.1.1; HMM-score: 13.9)
    lysine biosynthesis enzyme LysX (TIGR02144; HMM-score: 13.9)
  • TheSEED:  
    MiscellaneousMiscellaneous - no subcategoryEC 6.3.4.- Ligases that form carbon-nitrogen bonds Phosphoribosylamine--glycine ligase (EC 6.3.4.13) 
    Nucleosides and NucleotidesPurinesDe Novo Purine Biosynthesis Phosphoribosylamine--glycine ligase (EC 6.3.4.13) 
  • PFAM:
    ATP-grasp (CL0179) GARS_A; Phosphoribosylglycinamide synthetase, ATP-grasp (A) domain (PF01071; HMM-score: 226.7)
    Hybrid (CL0105) GARS_C; Phosphoribosylglycinamide synthetase, C domain (PF02843; HMM-score: 84.5)
    PreATP-grasp (CL0483) GARS_N; Phosphoribosylglycinamide synthetase, N domain (PF02844; HMM-score: 59.7)
    ATP-grasp (CL0179) ATP-grasp_3; ATP-grasp domain (PF02655; HMM-score: 29.7)
    ATP-grasp; ATP-grasp domain (PF02222; HMM-score: 23.5)
    RimK; RimK-like ATP-grasp domain (PF08443; HMM-score: 17.8)
    ATPgrasp_Ter; ATP-grasp in the biosynthetic pathway with Ter operon (PF15632; HMM-score: 17)
    CPSase_L_D2; Carbamoyl-phosphate synthase L chain, ATP binding domain (PF02786; HMM-score: 16.7)
    ATP-grasp_5; ATP-grasp domain (PF13549; HMM-score: 13.9)
    ATP-grasp_2; ATP-grasp domain (PF08442; HMM-score: 13.5)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: Mg2+, Mn2+
  • effectors:
  • protein partners:
    SA1984(asp23)alkaline shock protein 23  [1] (data from MRSA252)
    SA1409(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    SA1305(hu)DNA-binding protein II  [1] (data from MRSA252)
    SA0943-1(pdhA)pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SA0944(pdhB)pyruvate dehydrogenase E1 component subunit beta  [1] (data from MRSA252)
    SA0945(pdhC)branched-chain alpha-keto acid dehydrogenase E2 subunit  [1] (data from MRSA252)
    SA0946(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    SA1520(pykA)pyruvate kinase  [1] (data from MRSA252)
    SA0496(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    SA2044(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    SA2033(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    SA0497(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    SA2029(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    SA1084(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    SA1473(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    SA2045(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    SAS052(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    SA2031(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SA2016(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    SA2024(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    SA0506(tuf)elongation factor Tu  [1] (data from MRSA252)
    SA1528hypothetical protein  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.108
    • Ymax_pos: 62
    • Cmax: 0.134
    • Cmax_pos: 62
    • Smax: 0.114
    • Smax_pos: 60
    • Smean: 0.068
    • D: 0.093
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MTPIAEVHTEISESNHQGILDFAKQQNVDWVVIGPEQPLIDGLADILRANGFKVFGPNKQAAQIEGSKLFAKKIMKKYNIPTADYKEVERKKDALTYIENCELPVVVKKDGLAAGKGVIIADTIEAARSAIEIMYGDEEEGTVVFETFLEGEEFSLMTFVNGDLAVPFDCIAQDHKRAFDHDEGPNTGGMGAYCPVPHISDDVLKLTNETIAQPIAKAMLNEGYQFFGVLYIGAILTKDGPKVIEFNARFGDPEAQVLLSRMESDLMQHIIDLDEGKRTEFKWKNESIVGVMLASKGYPDAYEKGHKVSGFDLNENYFVSGLKKQGDTFVTSGGRVILAIGKGDNVQDAQRDAYEKVSQIQSDHLFYRHDIANKALQLK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: PurR
    PurR (TF) important in Purine metabolism  RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21

Relevant publications[edit source | edit]