From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2036 [new locus tag: SACOL_RS10625 ]
  • pan locus tag?: SAUPAN005292000
  • symbol: SACOL2036
  • pan gene symbol?: vga
  • synonym:
  • product: ABC transporter ATP-binding protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL2036 [new locus tag: SACOL_RS10625 ]
  • symbol: SACOL2036
  • product: ABC transporter ATP-binding protein
  • replicon: chromosome
  • strand: +
  • coordinates: 2093997..2095925
  • length: 1929
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    ATGATACTTTTACAACTCAATCATATATCAAAATCGTTCGATGGTGAAGATATATTTACT
    GATGTTGATTTTGAAGTAAAAACTGGTGAACGAATTGGTATCGTAGGAAGAAATGGCGCC
    GGTAAATCAACATTGATGAAAATTATAGCTGGCGTAGAAAACTATGATTCTGGAAATGTG
    TCAAAAATTAAAAACTTAAAACTAGGTTATTTAACTCAACAAATGACTTTAAATTCTAAT
    GCAACAGTTTTTGAAGAAATGTCAAAACCATTTGAACATATTAAACGAATGGAAAGCTTA
    ATCAAAGAAGAAACAGATTGGTTATCAAAACATGCAAATGATTACGATAGTGATACATAT
    AAAACACATATGTCCCGTTATGAATCTTTATCGAATCAATTTGAACAATTAGAAGGATAT
    CAATATGAAAGTAAAATTAAAACAGTACTTTACGGGTTAAATTTTAGTGAAGAAGATTTC
    AATAAACCTATCAATGATTTTAGCGGTGGCCAAAAAACACGTTTATCTTTAGCTCAAATG
    CTATTAAACGAACCTGATTTATTACTTTTAGATGAACCTACTAACCACTTAGATTTAGAA
    ACGACAAAGTGGCTTGAAGATTATCTACGTTATTTTAAAGGTGCAATCGTCATCATCAGC
    CATGATCGTTACTTTTTAGATAAAATAGTTACTCAAATTTATGATGTGGCTTTAGGTGAT
    GTCAAACGCTATGTTGGTAATTACGAGGAATTTATACAGCAACGAGATTTATATTATCAA
    AAACGAATGCAAGAATATGAAAGTCAACAAGCAGAAATAAAACGATTAGAAACTTTTGTT
    GAGAAAAATATTACCCGTGCTTCAACAAGTGGAATGGCAAAAAGTAGACGTAAGATTTTA
    GAAAAAATGGAACGCATTGATAAACCAATGTTAGATGCCAAAAGTGCAAATATTCAATTT
    GGCTTTGACCGGAATACAGGTAATGACGTCATGCATGTAAAAAATTTAGAAATCGGTTAT
    CAAACTGCAATTACCAAACCTATGAGTATAGAGGTCTCTAAAGGCGATCATATAGCAATC
    ATTGGGCCAAATGGTATTGGAAAATCGACCTTAATTAAAACTATTGCTAATCAACAAAAA
    GCGCTTAATGGCGATATTACTTTCGGCGCAAATTTACAAATTGGTTATTATGATCAAAAG
    CAAGCAGAATTTAAATCTAGTAAAACGATTTTAGATTATGTGTGGGATCAATATCCGTTA
    ATGAATGAAAAAGATATTCGAGCAGTTCTTGGACGTTTCTTATTTGTACAAGACGATGTT
    AAAAAGATAATTAATGATTTATCTGGTGGTGAAAAAGCACGTTTACTACTAGCACTACTT
    ATGTTGCAACGTGACAATGTACTTATTTTAGATGAACCTACCAACCACCTCGATATAGAT
    TCAAAAGAAATGTTAGAGCAAGCACTCCAACATTTTGAAGGAACAATACTATTTGTTTCC
    CATGATCGTTACTTTATTAACCAATTAGCAAACAAGGTATTTGATTTAACAATTGATGGC
    GGAAAGATGTATTTAGGAGATTATCAATATTACATTGAAAAAGTTGAGGAAGCGGAAGCG
    TTGAAAGCGCACCAAGAAGAACAGTCAGTTAACGTACAAGCACATAAAAAGTCTATGGAA
    CAATCGTCGTATCATAACCAAAAAGAACAAAGACGTGAACAACGCAAACTTGAACGACAA
    ATATCCGAGTGTGAAAATGAAATAGAAACTTTAGAGACTACTATCTTACAAATAGACGAG
    CAATTAACCCAACCAGAAGTGTATAACAATCCACAAAAAGCAAACGAATTAGCTATCCAA
    AAACAAGATAGCGAACAAAAATTAGAACACGCTATGTCTAAATGGGAAGAATTACAACAA
    AAACTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1929

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL2036 [new locus tag: SACOL_RS10625 ]
  • symbol: SACOL2036
  • description: ABC transporter ATP-binding protein
  • length: 642
  • theoretical pI: 5.07123
  • theoretical MW: 74445.7
  • GRAVY: -0.638474

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 390.8)
    Cellular processesCellular processesToxin production and resistanceputative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 172.2)
    MetabolismTransport and binding proteinsUnknown substrateputative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 172.2)
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 159.1)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 152.3)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingheme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 147.6)
    MetabolismTransport and binding proteinsOtherheme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 147.6)
    MetabolismTransport and binding proteinsUnknown substrateenergy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 143)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesurea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 142.6)
    MetabolismTransport and binding proteinsAnionsphosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 140.9)
    Cellular processesCellular processesPathogenesistype I secretion system ATPase (TIGR03375; HMM-score: 139.8)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion system ATPase (TIGR03375; HMM-score: 139.8)
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 139.2)
    Cellular processesCellular processesCell divisioncell division ATP-binding protein FtsE (TIGR02673; HMM-score: 135.6)
    Genetic information processingProtein fateProtein and peptide secretion and traffickinglipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 134.7)
    lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 134.5)
    MetabolismTransport and binding proteinsOtherdaunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 133.6)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherFeS assembly ATPase SufC (TIGR01978; HMM-score: 131.3)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 129.7)
    MetabolismTransport and binding proteinsCations and iron carrying compoundscobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 128.9)
    MetabolismTransport and binding proteinsAnionssulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 127.8)
    MetabolismTransport and binding proteinsUnknown substrateenergy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 127.1)
    Cellular processesCellular processesBiosynthesis of natural productsNHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 126.7)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesNHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 126.7)
    Cellular processesCellular processesBiosynthesis of natural productsNHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 125.9)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesNHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 125.9)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesurea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 125.8)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesputative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 120)
    MetabolismTransport and binding proteinsAnionsmolybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 119.2)
    MetabolismEnergy metabolismMethanogenesismethyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 116.9)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion system ATPase (TIGR01842; HMM-score: 116.1)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsnickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 113.6)
    MetabolismTransport and binding proteinsAnionsphosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 113.2)
    gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 112.3)
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 111.8)
    Cellular processesCellular processesOthernodulation ABC transporter NodI (TIGR01288; HMM-score: 111.6)
    MetabolismTransport and binding proteinsOthernodulation ABC transporter NodI (TIGR01288; HMM-score: 111.6)
    MetabolismTransport and binding proteinsOtherthiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 111.4)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingABC-type bacteriocin transporter (TIGR01193; HMM-score: 107.4)
    Genetic information processingProtein fateProtein modification and repairABC-type bacteriocin transporter (TIGR01193; HMM-score: 107.4)
    MetabolismTransport and binding proteinsOtherABC-type bacteriocin transporter (TIGR01193; HMM-score: 107.4)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 106.4)
    MetabolismTransport and binding proteinsUnknown substrateanchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 105)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsD-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 102.7)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharideslipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 100.2)
    MetabolismTransport and binding proteinsOtherlipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 100.2)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 98.7)
    Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidesLPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 98.4)
    MetabolismTransport and binding proteinsOtherLPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 98.4)
    MetabolismTransport and binding proteinsAnionsnitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 98.2)
    MetabolismTransport and binding proteinsOthernitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 98.2)
    MetabolismTransport and binding proteinsOtherantigen peptide transporter 2 (TIGR00958; HMM-score: 97.8)
    ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 96.8)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype I secretion system ATPase (TIGR01846; HMM-score: 95.4)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsnickel import ATP-binding protein NikD (TIGR02770; HMM-score: 89.4)
    ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 87.6)
    MetabolismTransport and binding proteinsOtherpigment precursor permease (TIGR00955; HMM-score: 85.7)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsglucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 84.8)
    MetabolismTransport and binding proteinsCarbohydrates, organic alcohols, and acidsperoxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 83.4)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminespolyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 81.7)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesglycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 77.9)
    D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 76.4)
    MetabolismCentral intermediary metabolismPhosphorus compoundsphosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 69.9)
    MetabolismTransport and binding proteinsAnionscystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 65.8)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminescyclic peptide transporter (TIGR01194; HMM-score: 58.7)
    MetabolismTransport and binding proteinsOthercyclic peptide transporter (TIGR01194; HMM-score: 58.7)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminescholine ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 56.6)
    MetabolismTransport and binding proteinsOthermulti drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 50.9)
    MetabolismTransport and binding proteinsOtherpleiotropic drug resistance family protein (TIGR00956; HMM-score: 50.1)
    MetabolismTransport and binding proteinsOtherrim ABC transporter (TIGR01257; HMM-score: 37)
    Cellular processesCellular processesChemotaxis and motilityflagellar protein export ATPase FliI (TIGR03496; EC 3.6.3.14; HMM-score: 26.6)
    Cellular processesCellular processesPathogenesistype III secretion apparatus H+-transporting two-sector ATPase (TIGR02546; EC 3.6.3.14; HMM-score: 25.9)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype III secretion apparatus H+-transporting two-sector ATPase (TIGR02546; EC 3.6.3.14; HMM-score: 25.9)
    Genetic information processingProtein synthesisOtherribosome-associated GTPase EngA (TIGR03594; HMM-score: 24.5)
    MetabolismEnergy metabolismATP-proton motive force interconversionATPase, FliI/YscN family (TIGR01026; EC 3.6.3.14; HMM-score: 24.3)
    Unknown functionGeneralsmall GTP-binding protein domain (TIGR00231; HMM-score: 24.1)
    Cellular processesCellular processesChemotaxis and motilityflagellar protein export ATPase FliI (TIGR03497; EC 3.6.3.14; HMM-score: 24.1)
    flagellar protein export ATPase FliI (TIGR03498; EC 3.6.3.14; HMM-score: 23.3)
    Genetic information processingProtein synthesisOtherGTP-binding protein Era (TIGR00436; HMM-score: 21.2)
    Genetic information processingProtein synthesisOtherribosome biogenesis GTP-binding protein YsxC (TIGR03598; HMM-score: 19)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairHolliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 18.5)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesNucleotide and nucleoside interconversionscytidylate kinase (TIGR00017; EC 2.7.4.14; HMM-score: 17.9)
    Genetic information processingProtein synthesisOtherObg family GTPase CgtA (TIGR02729; HMM-score: 17.8)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPantothenate and coenzyme Adephospho-CoA kinase (TIGR00152; EC 2.7.1.24; HMM-score: 15.2)
    MetabolismCentral intermediary metabolismPhosphorus compoundsphosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN (TIGR02322; HMM-score: 15.2)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype VII secretion protein EccCb (TIGR03925; HMM-score: 14.9)
    Genetic information processingProtein synthesisTranslation factorsribosome small subunit-dependent GTPase A (TIGR00157; EC 3.6.-.-; HMM-score: 13.6)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA modification GTPase TrmE (TIGR00450; EC 3.6.-.-; HMM-score: 11.3)
    Genetic information processingProtein fateProtein modification and repair[FeFe] hydrogenase H-cluster maturation GTPase HydF (TIGR03918; HMM-score: 11)
    MetabolismTransport and binding proteinsAmino acids, peptides and aminesLAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 10.8)
    Signal transductionRegulatory functionsProtein interactionsLAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 10.8)
    MetabolismCentral intermediary metabolismNitrogen metabolismurea carboxylase (TIGR02712; EC 6.3.4.6; HMM-score: 9.9)
    putative cytidylate kinase (TIGR02173; EC 2.7.4.14; HMM-score: 9.5)
    Cellular processesCellular processesChemotaxis and motilityflagellar biosynthesis protein FlhF (TIGR03499; HMM-score: 9.1)
    Cellular processesCellular processesCell divisionchromosome segregation protein SMC (TIGR02168; HMM-score: 3.5)
    Genetic information processingDNA metabolismChromosome-associated proteinschromosome segregation protein SMC (TIGR02168; HMM-score: 3.5)
  • TheSEED:  
    CBSS-393121.3.peg.2760 ABC transporter ATP-binding protein uup 
  • PFAM:
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 168.9)
    ABC_tran_Xtn; ABC transporter (PF12848; HMM-score: 76.9)
    AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 75.1)
    no clan definedABC_tran_CTD; ABC transporter C-terminal domain (PF16326; HMM-score: 47.4)
    P-loop_NTPase (CL0023) SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 45.6)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 34.4)
    AAA_22; AAA domain (PF13401; HMM-score: 30.7)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 30.5)
    NB-ARC; NB-ARC domain (PF00931; HMM-score: 26.3)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 26)
    AAA_24; AAA domain (PF13479; HMM-score: 25.4)
    NACHT; NACHT domain (PF05729; HMM-score: 24.6)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 24.1)
    ATP-synt_ab; ATP synthase alpha/beta family, nucleotide-binding domain (PF00006; HMM-score: 22.8)
    Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 22.3)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 22.1)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 21.4)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 20.7)
    ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 19.6)
    NTPase_1; NTPase (PF03266; HMM-score: 19.4)
    AAA_30; AAA domain (PF13604; HMM-score: 19.3)
    AAA_10; AAA-like domain (PF12846; HMM-score: 18.9)
    AAA_18; AAA domain (PF13238; HMM-score: 18.6)
    Dynamin_N; Dynamin family (PF00350; HMM-score: 18.3)
    AAA_28; AAA domain (PF13521; HMM-score: 18.3)
    AAA_33; AAA domain (PF13671; HMM-score: 17.3)
    FtsK_SpoIIIE; FtsK/SpoIIIE family (PF01580; HMM-score: 16)
    Cytidylate_kin; Cytidylate kinase (PF02224; HMM-score: 15.8)
    no clan definedSL4P; Uncharacterized Strongylid L4 protein (PF17618; HMM-score: 15.4)
    P-loop_NTPase (CL0023) TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 15.2)
    ArgK; ArgK protein (PF03308; HMM-score: 14.6)
    AAA_14; AAA domain (PF13173; HMM-score: 14.5)
    HAD (CL0137) Trehalose_PPase; Trehalose-phosphatase (PF02358; HMM-score: 14.2)
    P-loop_NTPase (CL0023) RuvB_N; Holliday junction DNA helicase ruvB N-terminus (PF05496; HMM-score: 14)
    cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 13.1)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 12.5)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 12.3)
    DUF87; Domain of unknown function DUF87 (PF01935; HMM-score: 11.4)
    AAA_27; AAA domain (PF13514; HMM-score: 11)
    AAA_23; AAA domain (PF13476; HMM-score: 9.7)
    C_Lectin (CL0056) Endostatin; Collagenase NC10 and Endostatin (PF06482; HMM-score: 8.5)
    P-loop_NTPase (CL0023) SRP54; SRP54-type protein, GTPase domain (PF00448; HMM-score: 6.8)
    no clan definedDASH_Spc34; DASH complex subunit Spc34 (PF08657; HMM-score: 6.2)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SACOL2117(fbaA)fructose-bisphosphate aldolase  [1] (data from MRSA252)
    SACOL2622(fdaB)fructose-1,6-bisphosphate aldolase  [1] (data from MRSA252)
    SACOL1199(ftsZ)cell division protein FtsZ  [1] (data from MRSA252)
    SACOL0593(fusA)elongation factor G  [1] (data from MRSA252)
    SACOL0838(gapA1)glyceraldehyde 3-phosphate dehydrogenase  [1] (data from MRSA252)
    SACOL1734(gapA2)glyceraldehyde 3-phosphate dehydrogenase 2  [1] (data from MRSA252)
    SACOL1622(glyS)glycyl-tRNA synthetase  [1] (data from MRSA252)
    SACOL1554(gnd)6-phosphogluconate dehydrogenase  [1] (data from MRSA252)
    SACOL1741(icd)isocitrate dehydrogenase  [1] (data from MRSA252)
    SACOL1288(infB)translation initiation factor IF-2  [1] (data from MRSA252)
    SACOL1102(pdhA)pyruvate dehydrogenase complex E1 component subunit alpha  [1] (data from MRSA252)
    SACOL2128(pdp)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    SACOL0966(pgi)glucose-6-phosphate isomerase  [1] (data from MRSA252)
    SACOL0839(pgk)phosphoglycerate kinase  [1] (data from MRSA252)
    SACOL1745(pyk)pyruvate kinase  [1] (data from MRSA252)
    SACOL2238(rplD)50S ribosomal protein L4  [1] (data from MRSA252)
    SACOL2224(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    SACOL0585(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    SACOL1257(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    SACOL0588(rpoB)DNA-directed RNA polymerase subunit beta  [1] (data from MRSA252)
    SACOL1274(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    SACOL2222(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SACOL2240(rpsJ)30S ribosomal protein S10  [1] (data from MRSA252)
    SACOL2215(rpsM)30S ribosomal protein S13  [1] (data from MRSA252)
    SACOL2230(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    SACOL1263(sucD)succinyl-CoA synthetase subunit alpha  [1] (data from MRSA252)
    SACOL0594(tuf)elongation factor Tu  [1] (data from MRSA252)
    SACOL03035'-nucleotidase  [1] (data from MRSA252)
    SACOL0944NADH dehydrogenase  [1] (data from MRSA252)
    SACOL1759universal stress protein  [1] (data from MRSA252)
    SACOL2173alkaline shock protein 23  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.112
    • Ymax_pos: 52
    • Cmax: 0.107
    • Cmax_pos: 13
    • Smax: 0.196
    • Smax_pos: 48
    • Smean: 0.102
    • D: 0.108
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MILLQLNHISKSFDGEDIFTDVDFEVKTGERIGIVGRNGAGKSTLMKIIAGVENYDSGNVSKIKNLKLGYLTQQMTLNSNATVFEEMSKPFEHIKRMESLIKEETDWLSKHANDYDSDTYKTHMSRYESLSNQFEQLEGYQYESKIKTVLYGLNFSEEDFNKPINDFSGGQKTRLSLAQMLLNEPDLLLLDEPTNHLDLETTKWLEDYLRYFKGAIVIISHDRYFLDKIVTQIYDVALGDVKRYVGNYEEFIQQRDLYYQKRMQEYESQQAEIKRLETFVEKNITRASTSGMAKSRRKILEKMERIDKPMLDAKSANIQFGFDRNTGNDVMHVKNLEIGYQTAITKPMSIEVSKGDHIAIIGPNGIGKSTLIKTIANQQKALNGDITFGANLQIGYYDQKQAEFKSSKTILDYVWDQYPLMNEKDIRAVLGRFLFVQDDVKKIINDLSGGEKARLLLALLMLQRDNVLILDEPTNHLDIDSKEMLEQALQHFEGTILFVSHDRYFINQLANKVFDLTIDGGKMYLGDYQYYIEKVEEAEALKAHQEEQSVNVQAHKKSMEQSSYHNQKEQRREQRKLERQISECENEIETLETTILQIDEQLTQPEVYNNPQKANELAIQKQDSEQKLEHAMSKWEELQQKL

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  2. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS ONE: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  3. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J. Proteome Res.: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  4. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int. J. Med. Microbiol.: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]