From AureoWiki
Jump to: navigation, search
NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_00525
  • pan locus tag?: SAUPAN002315000
  • symbol: SAOUHSC_00525
  • pan gene symbol?: rpoC
  • synonym:
  • product: DNA-directed RNA polymerase subunit beta'

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_00525
  • symbol: SAOUHSC_00525
  • product: DNA-directed RNA polymerase subunit beta'
  • replicon: chromosome
  • strand: +
  • coordinates: 525875..529471
  • length: 3597
  • essential: yes [1] DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    2161
    2221
    2281
    2341
    2401
    2461
    2521
    2581
    2641
    2701
    2761
    2821
    2881
    2941
    3001
    3061
    3121
    3181
    3241
    3301
    3361
    3421
    3481
    3541
    ATGAAAATAGGATTGGCTTCACCTGAAAAAATCCGTTCTTGGTCTTTTGGTGAAGTTAAA
    AAACCTGAAACAATCAACTACCGTACATTAAAACCTGAAAAAGATGGTCTATTCTGTGAA
    AGAATTTTCGGACCTACAAAAGACTGGGAATGTAGTTGTGGTAAATACAAACGTGTTCGC
    TACAAAGGCATGGTCTGTGACAGATGTGGAGTTGAAGTAACTAAATCTAAAGTACGTCGT
    GAAAGAATGGGTCACATTGAACTTGCTGCTCCAGTTTCTCACATTTGGTATTTCAAAGGT
    ATACCAAGTCGTATGGGATTATTACTTGACATGTCACCAAGAGCATTAGAAGAAGTTATT
    TACTTTGCTTCTTATGTTGTTGTAGATCCAGGTCCAACTGGTTTAGAAAAGAAAACTTTA
    TTATCTGAAGCTGAATTCAGAGATTATTATGATAAATACCCAGGTCAATTCGTTGCAAAA
    ATGGGTGCAGAAGGTATTAAAGATTTACTTGAAGAGATTGATCTTGACGAAGAACTTAAA
    TTGTTACGCGATGAGTTGGAATCAGCTACTGGTCAAAGACTTACTCGTGCAATTAAACGT
    TTAGAAGTTGTTGAATCATTCCGTAATTCAGGTAACAAACCTTCATGGATGATTTTAGAT
    GTACTTCCAATCATCCCACCAGAAATTCGTCCAATGGTTCAATTAGATGGTGGACGATTT
    GCAACAAGTGACTTAAACGACTTATACCGTCGTGTAATTAATCGAAATAATCGTTTGAAA
    CGTTTATTAGATTTAGGTGCACCTGGTATCATCGTTCAAAACGAAAAACGTATGTTACAA
    GAAGCCGTTGACGCTTTAATTGATAATGGTCGTCGTGGTCGTCCAGTTACTGGCCCAGGT
    AACCGTCCATTAAAATCTTTATCTCATATGTTAAAAGGTAAACAAGGTCGTTTCCGTCAA
    AACTTACTTGGTAAACGTGTTGACTATTCAGGACGTTCAGTTATTGCAGTAGGTCCAAGC
    TTGAAAATGTACCAATGTGGTTTACCAAAAGAAATGGCACTTGAACTATTTAAACCATTC
    GTAATGAAAGAATTAGTTCAACGTGAAATTGCAACTAACATTAAAAATGCGAAGAGTAAA
    ATCGAACGTATGGATGATGAAGTTTGGGACGTATTGGAAGAAGTAATTAGAGAACATCCT
    GTATTACTTAACCGTGCACCAACACTTCATAGACTTGGTATTCAAGCATTTGAACCAACT
    TTAGTTGAAGGTCGTGCGATTCGTCTACATCCACTTGTAACAACAGCTTATAACGCTGAC
    TTTGACGGTGACCAAATGGCGGTTCACGTTCCTTTATCAAAAGAGGCACAAGCTGAAGCA
    AGAATGTTGATGTTAGCAGCACAAAACATCTTGAACCCTAAAGATGGTAAACCTGTAGTT
    ACACCATCACAAGATATGGTACTTGGTAACTATTACCTTACTTTAGAAAGAAAAGATGCA
    GTAAATACAGGCGCAATCTTTAATAATACAAATGAAGTATTAAAAGCATATGCAAATGGC
    TTTGTACATTTACACACTAGAATTGGTGTACATGCAAGTTCGTTCAATAATCCAACATTT
    ACTGAAGAACAAAACAAAAAGATTCTTGCTACGTCAGTAGGTAAAATTATATTCAATGAA
    ATCATTCCAGATTCATTTGCTTATATTAATGAACCTACGCAAGAAAACTTAGAAAGAAAG
    ACACCAAACAGATATTTCATCGATCCTACAACTTTAGGTGAAGGTGGATTAAAAGAATAC
    TTTGAAAATGAAGAATTAATTGAACCTTTCAACAAAAAATTCTTAGGTAATATTATTGCA
    GAAGTATTCAACAGATTTAGCATCACTGATACATCAATGATGTTAGACCGTATGAAAGAC
    TTAGGATTCAAATTCTCATCTAAAGCTGGTATTACAGTAGGTGTTGCTGATATCGTAGTA
    TTACCTGATAAGCAACAAATACTTGATGAGCATGAAAAATTAGTCGACAGAATTACAAAA
    CAATTCAACCGTGGTTTAATCACTGAAGAAGAAAGATATAATGCAGTTGTTGAAATTTGG
    ACAGATGCAAAAGATCAAATTCAAGGTGAATTGATGCAATCACTTGATAAAACTAACCCA
    ATCTTCATGATGAGTGATTCAGGTGCCCGTGGTAACGCATCTAACTTTACACAGTTAGCA
    GGTATGCGTGGATTGATGGCCGCACCATCTGGTAAGATTATCGAATTACCAATCACATCT
    TCATTCCGTGAAGGTTTAACAGTACTTGAATACTTCATCTCAACTCACGGTGCACGTAAA
    GGTCTTGCCGATACAGCACTTAAAACAGCTGACTCAGGATATCTTACTCGTCGTCTTGTT
    GACGTGGCACAAGATGTTATTGTTCGTGAAGAAGACTGTGGTACTGATAGAGGTTTATTA
    GTTTCTGATATTAAAGAAGGTACAGAAATGATTGAACCATTTATCGAACGTATTGAAGGT
    CGTTATTCTAAAGAAACAATTCGTCATCCTGAAACTGATGAAATAATCATTCGTCCTGAT
    GAATTAATTACACCTGAAATTGCTAAGAAAATTACAGATGCTGGTATTGAACAAATGTAT
    ATTCGCTCAGCATTTACTTGTAACGCACGACATGGTGTTTGTGAAAAATGTTACGGTAAA
    AACCTTGCTACTGGTGAAAAAGTTGAAGTTGGTGAAGCAGTTGGTACAATTGCAGCCCAA
    TCTATCGGTGAACCAGGTACACAGCTTACAATGCGTACATTCCATACAGGTGGGGTAGCA
    GGTAGCGATATCACACAAGGTCTTCCTCGTATTCAAGAGATTTTCGAAGCACGTAACCCT
    AAAGGTCAAGCGGTAATTACGGAAATCGAAGGTGTCGTAGAAGATATTAAATTAGCAAAA
    GATAGACAACAAGAAATTGTTGTTAAAGGTGCTAATGAAACAAGATCATACCTTGCTTCA
    GGTACTTCAAGAATTATTGTAGAAATCGGTCAACCAGTTCAACGTGGTGAAGTATTAACT
    GAAGGTTCTATTGAACCTAAGAATTACTTATCTGTTGCTGGATTAAACGCGACTGAAAGC
    TACTTATTAAAAGAAGTACAAAAAGTTTACCGTATGCAAGGTGTAGAAATCGACGATAAA
    CACGTTGAGGTTATGGTTCGACAAATGTTACGTAAAGTTAGAATTATCGAAGCAGGTGAT
    ACGAAGTTATTACCAGGTTCATTAGTTGATATTCATAACTTTACAGATGCAAATAGAGAA
    GCATTTAAACACCGTAAGCGTCCTGCAACAGCTAAACCAGTATTACTTGGTATTACTAAA
    GCATCACTTGAAACAGAAAGTTTCTTATCTGCAGCATCATTCCAAGAAACAACAAGAGTT
    CTTACAGATGCAGCAATTAAAGGTAAGCGTGATGACTTATTAGGTCTTAAAGAAAACGTA
    ATTATTGGTAAGTTAATTCCAGCTGGTACTGGTATGAGACGTTATAGCGACGTAAAATAC
    GAAAAAACAGCTAAACCAGTTGCAGAAGTTGAATCTCAAACTGAAGTAACGGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2160
    2220
    2280
    2340
    2400
    2460
    2520
    2580
    2640
    2700
    2760
    2820
    2880
    2940
    3000
    3060
    3120
    3180
    3240
    3300
    3360
    3420
    3480
    3540
    3597

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAOUHSC_00525
  • symbol: SAOUHSC_00525
  • description: DNA-directed RNA polymerase subunit beta'
  • length: 1198
  • theoretical pI: 7.01614
  • theoretical MW: 134273
  • GRAVY: -0.354341

Function[edit source | edit]

  • reaction:
    EC 2.7.7.6?  ExPASy
    DNA-directed RNA polymeraseNucleoside triphosphate + RNA(n) = diphosphate + RNA(n+1)
  • TIGRFAM:
    Genetic information processingTranscriptionDNA-dependent RNA polymeraseDNA-directed RNA polymerase, beta' subunit (TIGR02386; EC 2.7.7.6; HMM-score: 1883.6)
    DNA-directed RNA polymerase, gamma subunit (TIGR02387; EC 2.7.7.6; HMM-score: 843.5)
    Genetic information processingTranscriptionDNA-dependent RNA polymeraseDNA-directed RNA polymerase, beta subunit (TIGR02388; EC 2.7.7.6; HMM-score: 645.3)
    DNA-directed RNA polymerase subunit A' (TIGR02390; EC 2.7.7.6; HMM-score: 320.8)
    Genetic information processingTranscriptionDNA-dependent RNA polymeraseDNA-directed RNA polymerase, subunit A (TIGR02389; EC 2.7.7.6; HMM-score: 115)
  • TheSEED:  
    Mycobacterium virulence operon involved in DNA transcription DNA-directed RNA polymerase beta' subunit (EC 2.7.7.6) 
    RNA polymerase bacterial DNA-directed RNA polymerase beta' subunit (EC 2.7.7.6) 
  • PFAM:
    no clan definedRNA_pol_Rpb1_1; RNA polymerase Rpb1, domain 1 (PF04997; HMM-score: 294.8)
    RNA_pol_Rpb1_5; RNA polymerase Rpb1, domain 5 (PF04998; HMM-score: 233.5)
    RNA_pol_Rpb1_2; RNA polymerase Rpb1, domain 2 (PF00623; HMM-score: 140.1)
    RNA_pol_Rpb1_3; RNA polymerase Rpb1, domain 3 (PF04983; HMM-score: 117.5)
    RNA_pol_Rpb1_4; RNA polymerase Rpb1, domain 4 (PF05000; HMM-score: 54.7)
    Hybrid (CL0105) Peptidase_M23; Peptidase family M23 (PF01551; HMM-score: 17.6)

Structure, modifications & interactions[edit source | edit]

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.119
    • Ymax_pos: 12
    • Cmax: 0.123
    • Cmax_pos: 23
    • Smax: 0.178
    • Smax_pos: 1
    • Smean: 0.134
    • D: 0.125
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MKIGLASPEKIRSWSFGEVKKPETINYRTLKPEKDGLFCERIFGPTKDWECSCGKYKRVRYKGMVCDRCGVEVTKSKVRRERMGHIELAAPVSHIWYFKGIPSRMGLLLDMSPRALEEVIYFASYVVVDPGPTGLEKKTLLSEAEFRDYYDKYPGQFVAKMGAEGIKDLLEEIDLDEELKLLRDELESATGQRLTRAIKRLEVVESFRNSGNKPSWMILDVLPIIPPEIRPMVQLDGGRFATSDLNDLYRRVINRNNRLKRLLDLGAPGIIVQNEKRMLQEAVDALIDNGRRGRPVTGPGNRPLKSLSHMLKGKQGRFRQNLLGKRVDYSGRSVIAVGPSLKMYQCGLPKEMALELFKPFVMKELVQREIATNIKNAKSKIERMDDEVWDVLEEVIREHPVLLNRAPTLHRLGIQAFEPTLVEGRAIRLHPLVTTAYNADFDGDQMAVHVPLSKEAQAEARMLMLAAQNILNPKDGKPVVTPSQDMVLGNYYLTLERKDAVNTGAIFNNTNEVLKAYANGFVHLHTRIGVHASSFNNPTFTEEQNKKILATSVGKIIFNEIIPDSFAYINEPTQENLERKTPNRYFIDPTTLGEGGLKEYFENEELIEPFNKKFLGNIIAEVFNRFSITDTSMMLDRMKDLGFKFSSKAGITVGVADIVVLPDKQQILDEHEKLVDRITKQFNRGLITEEERYNAVVEIWTDAKDQIQGELMQSLDKTNPIFMMSDSGARGNASNFTQLAGMRGLMAAPSGKIIELPITSSFREGLTVLEYFISTHGARKGLADTALKTADSGYLTRRLVDVAQDVIVREEDCGTDRGLLVSDIKEGTEMIEPFIERIEGRYSKETIRHPETDEIIIRPDELITPEIAKKITDAGIEQMYIRSAFTCNARHGVCEKCYGKNLATGEKVEVGEAVGTIAAQSIGEPGTQLTMRTFHTGGVAGSDITQGLPRIQEIFEARNPKGQAVITEIEGVVEDIKLAKDRQQEIVVKGANETRSYLASGTSRIIVEIGQPVQRGEVLTEGSIEPKNYLSVAGLNATESYLLKEVQKVYRMQGVEIDDKHVEVMVRQMLRKVRIIEAGDTKLLPGSLVDIHNFTDANREAFKHRKRPATAKPVLLGITKASLETESFLSAASFQETTRVLTDAAIKGKRDDLLGLKENVIIGKLIPAGTGMRRYSDVKYEKTAKPVAEVESQTEVTE

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Roy R Chaudhuri, Andrew G Allen, Paul J Owen, Gil Shalom, Karl Stone, Marcus Harrison, Timothy A Burgis, Michael Lockyer, Jorge Garcia-Lara, Simon J Foster, Stephen J Pleasance, Sarah E Peters, Duncan J Maskell, Ian G Charles
    Comprehensive identification of essential Staphylococcus aureus genes using Transposon-Mediated Differential Hybridisation (TMDH).
    BMC Genomics: 2009, 10;291
    [PubMed:19570206] [WorldCat.org] [DOI] (I e)
  2. 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  3. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  4. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  5. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet.: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]

M Aboshkiwa, B al-Ani, G Coleman, G Rowland
Cloning and physical mapping of the Staphylococcus aureus rplL, rpoB and rpoC genes, encoding ribosomal protein L7/L12 and RNA polymerase subunits beta and beta'.
J. Gen. Microbiol.: 1992, 138(9);1875-80
[PubMed:1402788] [WorldCat.org] [DOI] (P p)
M Aboshkiwa, G Rowland, G Coleman
Nucleotide sequence of the Staphylococcus aureus RNA polymerase rpoB gene and comparison of its predicted amino acid sequence with those of other bacteria.
Biochim. Biophys. Acta: 1995, 1262(1);73-8
[PubMed:7772603] [WorldCat.org] (P p)