From AureoWiki
Jump to: navigation, search
NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_01234
  • pan locus tag?: SAUPAN003557000
  • symbol: tsf
  • pan gene symbol?: tsf
  • synonym:
  • product: elongation factor Ts

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_01234
  • symbol: tsf
  • product: elongation factor Ts
  • replicon: chromosome
  • strand: +
  • coordinates: 1181770..1182651
  • length: 882
  • essential: yes [1] DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGGCAACTATTTCAGCAAAACTTGTTAAAGAATTACGTGAAAAAACTGGCGCGGGTATG
    ATGGATTGTAAAAAAGCGCTAACTGAAACTGATGGTGACATCGATAAAGCGATTGACTAC
    CTACGTGAAAAAGGTATTGCTAAAGCAGCTAAAAAAGCAGACCGTATTGCGGCTGAAGGT
    TTAGTACATGTAGAAACTAAAGGTAACGACGCAGTTATCGTTGAAATCAACTCTGAAACA
    GACTTTGTTGCTCGTAACGAAGGTTTCCAAGAGTTAGTTAAAGAAATCGCTAATCAAGTA
    TTAGATACAAAAGCTGAAACTGTTGAAGCTTTAATGGAAACAACTTTACCAAATGGTAAA
    TCAGTTGATGAAAGAATTAAAGAAGCAATTTCAACAATCGGTGAAAAATTAAGTGTTCGT
    CGTTTTGCTATCAGAACTAAAACTGATAACGATGCTTTCGGCGCTTACTTACACATGGGT
    GGACGCATTGGTGTATTAACAGTTGTTGAAGGTTCAACTGACGAAGAAGCAGCAAGAGAC
    GTTGCTATGCATATCGCTGCAATCAACCCTAAATATGTTTCTTCTGAACAAGTTAGCGAA
    GAAGAAATCAACCACGAAAGAGAAGTTTTAAAACAACAAGCATTAAATGAAGGTAAACCA
    GAAAACATCGTTGAAAAAATGGTGGAAGGACGTTTACGTAAATACTTACAAGAAATTTGT
    GCTGTAGATCAAGACTTCGTTAAAAACCCTGATGTAACAGTTGAAGCTTTCTTAAAAACA
    AAAGGTGGAAAACTTGTTGACTTCGTACGCTATGAAGTAGGCGAAGGTATGGAAAAACGC
    GAAGAAAACTTTGCGGATGAAGTTAAAGGACAAATGAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    882

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAOUHSC_01234
  • symbol: Tsf
  • description: elongation factor Ts
  • length: 293
  • theoretical pI: 4.76664
  • theoretical MW: 32493.7
  • GRAVY: -0.476451

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein synthesisTranslation factorstranslation elongation factor Ts (TIGR00116; HMM-score: 389.4)
    Unknown functionGeneralDNA-binding protein, YbaB/EbfC family (TIGR00103; HMM-score: 15.2)
  • TheSEED:  
    Protein MetabolismProtein biosynthesisTranslation elongation factors bacterial Translation elongation factor Ts 
    CBSS-312309.3.peg.1965 Translation elongation factor Ts 
  • PFAM:
    no clan definedEF_TS; Elongation factor TS (PF00889; HMM-score: 252.9)
    UBA (CL0214) HOIP-UBA; HOIP UBA domain pair (PF16678; HMM-score: 16.9)
    no clan definedKu_C; Ku70/Ku80 C-terminal arm (PF03730; HMM-score: 15.9)
    HBS1_N; HBS1 N-terminus (PF08938; HMM-score: 13.8)
    DUF3150; Protein of unknown function (DUF3150) (PF11348; HMM-score: 13.7)
    DUF2497; Protein of unknown function (DUF2497) (PF10691; HMM-score: 12.2)
    RIIa (CL0068) RIIa; Regulatory subunit of type II PKA R-subunit (PF02197; HMM-score: 11.4)

Structure, modifications & interactions[edit source | edit]

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 10
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.147
    • Ymax_pos: 13
    • Cmax: 0.141
    • Cmax_pos: 50
    • Smax: 0.274
    • Smax_pos: 1
    • Smean: 0.206
    • D: 0.17
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MATISAKLVKELREKTGAGMMDCKKALTETDGDIDKAIDYLREKGIAKAAKKADRIAAEGLVHVETKGNDAVIVEINSETDFVARNEGFQELVKEIANQVLDTKAETVEALMETTLPNGKSVDERIKEAISTIGEKLSVRRFAIRTKTDNDAFGAYLHMGGRIGVLTVVEGSTDEEAARDVAMHIAAINPKYVSSEQVSEEEINHEREVLKQQALNEGKPENIVEKMVEGRLRKYLQEICAVDQDFVKNPDVTVEAFLKTKGGKLVDFVRYEVGEGMEKREENFADEVKGQMK

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 2.19 2.20 2.21 2.22 2.23 2.24 2.25

Relevant publications[edit source | edit]