From AureoWiki
Jump to: navigation, search
NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_01226
  • pan locus tag?: SAUPAN003552000
  • symbol: hslU
  • pan gene symbol?: hslU
  • synonym:
  • product: ATP-dependent protease ATP-binding subunit HslU

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_01226
  • symbol: hslU
  • product: ATP-dependent protease ATP-binding subunit HslU
  • replicon: chromosome
  • strand: +
  • coordinates: 1178277..1179680
  • length: 1404
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    ATGGATACAGCTGGAATAAGATTAACTCCAAAAGAAATCGTATCTAAATTAAATGAATAC
    ATCGTTGGACAAAATGATGCTAAACGTAAAGTGGCAATTGCCCTACGTAATCGATACAGA
    AGAAGTTTATTAGATGAGGAATCAAAGCAAGAAATTTCACCTAAAAATATTTTGATGATT
    GGACCAACCGGCGTTGGTAAAACTGAAATTGCAAGAAGAATGGCCAAAGTTGTCGGCGCG
    CCATTTATAAAAGTAGAAGCTACTAAATTTACTGAGGTAGGTTATGTAGGACGAGATGTT
    GAAAGTATGGTTAGAGATCTTGTTGATGTTTCAGTAAGATTAGTCAAGGCGCAGAAAAAA
    TCATTGGTACAAGATGAAGCAACAGCTAAGGCCAATGAAAAACTTGTTAAGTTATTAGTT
    CCAAGTATGAAAAAGAAAGCGTCTCAAACGAATAATCCTTTAGAGTCACTTTTCGGAGGT
    GCAATTCCAAATTTCGGACAAAATAACGAAGATGAAGAAGAACCACCTACTGAGGAAATT
    AAAACAAAACGTTCTGAAATTAAGAGACAGCTAGAAGAAGGCAAACTTGAAAAAGAAAAG
    GTAAGAATTAAAGTCGAACAAGATCCTGGTGCTTTAGGTATGCTAGGTACAAATCAAAAT
    CAGCAAATGCAAGAGATGATGAATCAATTAATGCCTAAAAAGAAAGTTGAGCGAGAAGTT
    GCTGTTGAGACGGCAAGGAAAATCTTAGCTGATAGTTATGCGGATGAACTAATTGATCAA
    GAAAGCGCTAACCAAGAAGCGCTTGAATTAGCAGAACAAATGGGTATCATCTTTATAGAT
    GAAATCGACAAAGTTGCGACGAATAATCATAATAGTGGTCAAGATGTCTCAAGACAAGGT
    GTTCAAAGAGATATTTTACCTATACTTGAAGGTAGCGTTATTCAAACCAAATATGGTACT
    GTGAATACTGAACATATGCTGTTTATAGGTGCTGGAGCTTTCCATGTATCTAAGCCGAGT
    GACTTGATACCAGAATTGCAAGGTCGTTTTCCGATTAGAGTTGAACTTGATAGTTTATCG
    GTAGAAGATTTTGTAAGAATTTTGACAGAACCAAAATTGTCATTAATTAAACAATATGAA
    GCATTGCTTCAAACAGAAGAAGTTACTGTAAACTTTACCGATGAAGCAATTACTCGCTTA
    GCTGAGATTGCTTATCAAGTAAATCAAGATACAGACAACATTGGTGCACGTCGACTTCAT
    ACAATTTTAGAAAAGATGCTAGAAGATTTATCATTCGAAGCACCAAGTATGCCGAATGCA
    GTTGTAGATATTACCCCACAATATGTTGATGATAAATTAAAATCAATTTCAACAAATAAA
    GATTTAAGTGCATTTATTCTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1404

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAOUHSC_01226
  • symbol: HslU
  • description: ATP-dependent protease ATP-binding subunit HslU
  • length: 467
  • theoretical pI: 4.95489
  • theoretical MW: 52314.5
  • GRAVY: -0.428266

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein fateProtein folding and stabilizationATP-dependent protease HslVU, ATPase subunit (TIGR00390; HMM-score: 621)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 206)
    Genetic information processingProtein fateProtein folding and stabilizationATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 206)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent Clp protease ATP-binding subunit ClpA (TIGR02639; HMM-score: 46.4)
    26S proteasome subunit P45 family (TIGR01242; HMM-score: 36.4)
    AAA family ATPase, CDC48 subfamily (TIGR01243; HMM-score: 30)
    Cellular processesCellular processesCell divisionATP-dependent metallopeptidase HflB (TIGR01241; EC 3.4.24.-; HMM-score: 27.4)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent metallopeptidase HflB (TIGR01241; EC 3.4.24.-; HMM-score: 27.4)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairHolliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 26.1)
    Cellular processesCellular processesOthergas vesicle protein GvpN (TIGR02640; HMM-score: 22.1)
    Cellular processesCellular processesChemotaxis and motilityflagellar biosynthesis protein FlhF (TIGR03499; HMM-score: 21.4)
    Cellular processesCellular processesPathogenesistype VI secretion ATPase, ClpV1 family (TIGR03345; HMM-score: 18.3)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype VI secretion ATPase, ClpV1 family (TIGR03345; HMM-score: 18.3)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype VII secretion AAA-ATPase EccA (TIGR03922; HMM-score: 18)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesendopeptidase La (TIGR00763; EC 3.4.21.53; HMM-score: 16.8)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairorc1/cdc6 family replication initiation protein (TIGR02928; HMM-score: 15.7)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA 2-selenouridine synthase (TIGR03167; EC 2.9.1.-; HMM-score: 15.6)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA polymerase III, subunit gamma and tau (TIGR02397; EC 2.7.7.7; HMM-score: 11.7)
    type IV conjugative transfer system coupling protein TraD (TIGR02759; HMM-score: 11.7)
  • TheSEED:  
    Protein MetabolismProtein degradationProteasome bacterial ATP-dependent hsl protease ATP-binding subunit HslU 
    Protein degradationProteolysis in bacteria, ATP-dependent ATP-dependent hsl protease ATP-binding subunit HslU 
  • PFAM:
    P-loop_NTPase (CL0023) AAA_2; AAA domain (Cdc48 subfamily) (PF07724; HMM-score: 147.1)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 58.4)
    no clan definedClpB_D2-small; C-terminal, D2-small domain, of ClpB protein (PF10431; HMM-score: 31.1)
    P-loop_NTPase (CL0023) AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 30.8)
    MCM; MCM2/3/5 family (PF00493; HMM-score: 21.6)
    RuvB_N; Holliday junction DNA helicase ruvB N-terminus (PF05496; HMM-score: 21.4)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 19.8)
    AAA_22; AAA domain (PF13401; HMM-score: 19.8)
    Sigma54_activat; Sigma-54 interaction domain (PF00158; HMM-score: 19.2)
    TIP49; TIP49 C-terminus (PF06068; HMM-score: 18.8)
    AAA_28; AAA domain (PF13521; HMM-score: 17.7)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 17.4)
    AAA_33; AAA domain (PF13671; HMM-score: 16.2)
    Zeta_toxin; Zeta toxin (PF06414; HMM-score: 15.9)
    TniB; Bacterial TniB protein (PF05621; HMM-score: 15.4)
    AAA_18; AAA domain (PF13238; HMM-score: 14.6)
    AFG1_ATPase; AFG1-like ATPase (PF03969; HMM-score: 14.4)
    DEAD; DEAD/DEAH box helicase (PF00270; HMM-score: 14.2)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 13.8)
    TrwB_AAD_bind; Type IV secretion-system coupling protein DNA-binding domain (PF10412; HMM-score: 13.6)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 13.5)
    IPT; Isopentenyl transferase (PF01745; HMM-score: 13.1)
    AAA_24; AAA domain (PF13479; HMM-score: 13.1)
    ResIII; Type III restriction enzyme, res subunit (PF04851; HMM-score: 13.1)
    NTPase_1; NTPase (PF03266; HMM-score: 11.3)
    no clan definedNifW; Nitrogen fixation protein NifW (PF03206; HMM-score: 11)
    P-loop_NTPase (CL0023) AAA_19; AAA domain (PF13245; HMM-score: 8.3)

Structure, modifications & interactions[edit source | edit]

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.95
    • Cytoplasmic Membrane Score: 0.05
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.102
    • Ymax_pos: 11
    • Cmax: 0.108
    • Cmax_pos: 24
    • Smax: 0.152
    • Smax_pos: 1
    • Smean: 0.092
    • D: 0.098
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MDTAGIRLTPKEIVSKLNEYIVGQNDAKRKVAIALRNRYRRSLLDEESKQEISPKNILMIGPTGVGKTEIARRMAKVVGAPFIKVEATKFTEVGYVGRDVESMVRDLVDVSVRLVKAQKKSLVQDEATAKANEKLVKLLVPSMKKKASQTNNPLESLFGGAIPNFGQNNEDEEEPPTEEIKTKRSEIKRQLEEGKLEKEKVRIKVEQDPGALGMLGTNQNQQMQEMMNQLMPKKKVEREVAVETARKILADSYADELIDQESANQEALELAEQMGIIFIDEIDKVATNNHNSGQDVSRQGVQRDILPILEGSVIQTKYGTVNTEHMLFIGAGAFHVSKPSDLIPELQGRFPIRVELDSLSVEDFVRILTEPKLSLIKQYEALLQTEEVTVNFTDEAITRLAEIAYQVNQDTDNIGARRLHTILEKMLEDLSFEAPSMPNAVVDITPQYVDDKLKSISTNKDLSAFIL

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 1.49 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  2. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  3. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-3661
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  4. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet.: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]