From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1097 [new locus tag: SA_RS06210 ]
  • pan locus tag?: SAUPAN003552000
  • symbol: hslU
  • pan gene symbol?: hslU
  • synonym:
  • product: ATP-dependent protease ATP-binding subunit HslU

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1097 [new locus tag: SA_RS06210 ]
  • symbol: hslU
  • product: ATP-dependent protease ATP-binding subunit HslU
  • replicon: chromosome
  • strand: +
  • coordinates: 1242651..1244054
  • length: 1404
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    ATGGATACAGCTGGAATAAGATTAACTCCAAAAGAAATCGTATCTAAATTAAATGAATAT
    ATCGTTGGACAAAATGATGCTAAACGTAAAGTGGCAATTGCCCTACGTAATCGATACAGA
    AGAAGTTTATTAGATGAGGAATCAAAGCAAGAAATTTCACCTAAAAATATTTTGATGATT
    GGACCAACCGGCGTTGGTAAAACTGAAATTGCAAGAAGAATGGCCAAAGTTGTCGGCGCG
    CCATTTATAAAAGTAGAAGCTACTAAATTTACTGAGCTAGGTTATGTAGGACGAGATGTT
    GAAAGTATGGTTAGAGATCTTGTTGATGTTTCAGTAAGATTAGTCAAGGCGCAGAAAAAA
    TCATTGGTACAAGATGAAGCAACAGCTAAGGCCAATGAAAAACTTGTTAAGTTATTAGTT
    CCAAGTATGAAAAAGAAAGCGTCTCAAACGAATAATCCTTTAGAGTCACTTTTCGGAGGT
    GCAATTCCAAATTTCGGACAAAATAACGAAGATGAAGAAGAACCACCTACTGAGGAAATT
    AAAACAAAACGTTCTGAAATTAAGAGACAGCTAGAAGAAGGCAAACTTGAAAAAGAAAAG
    GTAAGAATTAAAGTCGAACAAGATCCTGGTGCTTTAGGTATGCTAGGTACAAATCAAAAT
    CAGCAAATGCAAGAGATGATGAATCAATTAATGCCTAAAAAGAAAGTTGAGCGAGAAGTT
    GCTGTTGAGACGGCAAGGAAAATCTTAGCTGATAGTTATGCGGATGAACTAATTGATCAA
    GAAAGCGCTAACCAAGAAGCGCTTGAATTAGCAGAACAAATGGGTATCATCTTTATAGAT
    GAAATCGACAAAGTTGCGACGAATAATCATAATAGTGGTCAAGATGTCTCAAGACAAGGT
    GTTCAAAGAGATATTTTACCTATACTTGAAGGTAGCGTTATTCAAACCAAATATGGTACT
    GTGAATACTGAACATATGCTGTTTATAGGTGCTGGAGCTTTCCATGTATCTAAGCCGAGT
    GACTTGATACCAGAATTGCAAGGTCGTTTTCCGATTAGAGTTGAACTTGATAGTTTATCG
    GTAGAAGATTTTGTAAGAATTTTGACAGAACCAAAATTGTCATTAATTAAACAATATGAA
    GCATTGCTTCAAACAGAAGAAGTTACTGTAAACTTTACCGATGAAGCAATTACTCGCTTA
    GCTGAGATTGCTTATCAAGTAAATCAAGATACAGACAACATTGGTGCACGTCGACTTCAT
    ACAATTTTAGAAAAGATGCTAGAAGATTTATCATTCGAAGCACCAAGTATGCCGAATGCA
    GTTGTAGATATTACCCCACAATATGTTGATGATAAATTAAAATCAATTTCAACAAATAAA
    GATTTAAGTGCATTTATTCTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1404

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1097 [new locus tag: SA_RS06210 ]
  • symbol: HslU
  • description: ATP-dependent protease ATP-binding subunit HslU
  • length: 467
  • theoretical pI: 4.95489
  • theoretical MW: 52328.5
  • GRAVY: -0.429122

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein fateProtein folding and stabilizationATP-dependent protease HslVU, ATPase subunit (TIGR00390; HMM-score: 618.7)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 205.4)
    Genetic information processingProtein fateProtein folding and stabilizationATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 205.4)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent Clp protease ATP-binding subunit ClpA (TIGR02639; HMM-score: 46.4)
    26S proteasome subunit P45 family (TIGR01242; HMM-score: 36.3)
    AAA family ATPase, CDC48 subfamily (TIGR01243; HMM-score: 29.8)
    Cellular processesCellular processesCell divisionATP-dependent metallopeptidase HflB (TIGR01241; EC 3.4.24.-; HMM-score: 27.9)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent metallopeptidase HflB (TIGR01241; EC 3.4.24.-; HMM-score: 27.9)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairHolliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 26)
    Genetic information processingProtein fateProtein folding and stabilizationATP-dependent chaperone protein ClpB (TIGR03346; HMM-score: 24.6)
    Cellular processesCellular processesOthergas vesicle protein GvpN (TIGR02640; HMM-score: 21.7)
    Cellular processesCellular processesChemotaxis and motilityflagellar biosynthesis protein FlhF (TIGR03499; HMM-score: 20.9)
    Cellular processesCellular processesPathogenesistype VI secretion ATPase, ClpV1 family (TIGR03345; HMM-score: 18.4)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype VI secretion ATPase, ClpV1 family (TIGR03345; HMM-score: 18.4)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype VII secretion AAA-ATPase EccA (TIGR03922; HMM-score: 17.9)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesendopeptidase La (TIGR00763; EC 3.4.21.53; HMM-score: 16.5)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairorc1/cdc6 family replication initiation protein (TIGR02928; HMM-score: 15.7)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA 2-selenouridine synthase (TIGR03167; EC 2.9.1.-; HMM-score: 15.5)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA polymerase III, subunit gamma and tau (TIGR02397; EC 2.7.7.7; HMM-score: 11.7)
    type IV conjugative transfer system coupling protein TraD (TIGR02759; HMM-score: 11.6)
  • TheSEED:  
    Protein MetabolismProtein degradationProteasome bacterial ATP-dependent hsl protease ATP-binding subunit HslU 
    Protein degradationProteolysis in bacteria, ATP-dependent ATP-dependent hsl protease ATP-binding subunit HslU 
  • PFAM:
    P-loop_NTPase (CL0023) AAA_2; AAA domain (Cdc48 subfamily) (PF07724; HMM-score: 147.3)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 57.8)
    no clan definedClpB_D2-small; C-terminal, D2-small domain, of ClpB protein (PF10431; HMM-score: 31.1)
    P-loop_NTPase (CL0023) AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 29.9)
    MCM; MCM2/3/5 family (PF00493; HMM-score: 21.4)
    RuvB_N; Holliday junction DNA helicase ruvB N-terminus (PF05496; HMM-score: 21.3)
    AAA_22; AAA domain (PF13401; HMM-score: 19.9)
    Sigma54_activat; Sigma-54 interaction domain (PF00158; HMM-score: 19.3)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 19.2)
    TIP49; TIP49 C-terminus (PF06068; HMM-score: 18.9)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 17.8)
    AAA_28; AAA domain (PF13521; HMM-score: 17.6)
    Zeta_toxin; Zeta toxin (PF06414; HMM-score: 16.3)
    AAA_33; AAA domain (PF13671; HMM-score: 16.1)
    TniB; Bacterial TniB protein (PF05621; HMM-score: 15.3)
    AAA_18; AAA domain (PF13238; HMM-score: 14.7)
    AFG1_ATPase; AFG1-like ATPase (PF03969; HMM-score: 14.4)
    DEAD; DEAD/DEAH box helicase (PF00270; HMM-score: 14.2)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 13.9)
    TrwB_AAD_bind; Type IV secretion-system coupling protein DNA-binding domain (PF10412; HMM-score: 13.6)
    ResIII; Type III restriction enzyme, res subunit (PF04851; HMM-score: 13.5)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 13.2)
    IPT; Isopentenyl transferase (PF01745; HMM-score: 13.1)
    AAA_24; AAA domain (PF13479; HMM-score: 12.8)
    no clan definedNifW; Nitrogen fixation protein NifW (PF03206; HMM-score: 11)
    P-loop_NTPase (CL0023) AAA_19; AAA domain (PF13245; HMM-score: 8.2)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA1984(asp23)alkaline shock protein 23  [1] (data from MRSA252)
    SA1517(citC)isocitrate dehydrogenase  [1] (data from MRSA252)
    SA0002(dnaN)DNA polymerase III subunit beta  [1] (data from MRSA252)
    SA0869(fabI)enoyl-ACP reductase  [1] (data from MRSA252)
    SA1029(ftsZ)cell division protein FtsZ  [1] (data from MRSA252)
    SA0505(fus)elongation factor G  [1] (data from MRSA252)
    SA1510(gapB)glyceraldehyde 3-phosphate dehydrogenase 2  [1] (data from MRSA252)
    SA0375(guaB)inositol-monophosphate dehydrogenase  [1] (data from MRSA252)
    SA1305(hu)DNA-binding protein II  [1] (data from MRSA252)
    SA1112(infB)translation initiation factor IF-2  [1] (data from MRSA252)
    SA2400(mqo2)malate:quinone oxidoreductase  [1] (data from MRSA252)
    SA1902(murA)UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [1] (data from MRSA252)
    SA1926(murZ)UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [1] (data from MRSA252)
    SA1244(odhB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    SA0943-1(pdhA)pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SA0944(pdhB)pyruvate dehydrogenase E1 component subunit beta  [1] (data from MRSA252)
    SA0945(pdhC)branched-chain alpha-keto acid dehydrogenase E2 subunit  [1] (data from MRSA252)
    SA0946(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    SA1938(pdp)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    SA0823(pgi)glucose-6-phosphate isomerase  [1] (data from MRSA252)
    SA1520(pykA)pyruvate kinase  [1] (data from MRSA252)
    SA0496(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    SA2044(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    SA2035(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    SA2033(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    SA0497(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    SA0498(rplL)50S ribosomal protein L7/L12  [1] (data from MRSA252)
    SA2029(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    SA2022(rplQ)50S ribosomal protein L17  [1] (data from MRSA252)
    SA1084(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    SA1473(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    SA2042(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    SA2045(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    SA1099(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    SA2041(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    SAS052(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    SA2031(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SA2016(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    SA2024(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    SA2038(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    SA2043(rpsS)30S ribosomal protein S19  [1] (data from MRSA252)
    SA1382(sodA)superoxide dismutase SodA  [1] (data from MRSA252)
    SA0107(spa)immunoglobulin G binding protein A  [1] (data from MRSA252)
    SA1245(sucA)2-oxoglutarate dehydrogenase E1  [1] (data from MRSA252)
    SA0506(tuf)elongation factor Tu  [1] (data from MRSA252)
    SA0802hypothetical protein  [1] (data from MRSA252)
    SA0829hypothetical protein  [1] (data from MRSA252)
    SA1532hypothetical protein  [1] (data from MRSA252)
    SA1571D-alanine aminotransferase  [1] (data from MRSA252)
    SA2327pyruvate oxidase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.95
    • Cytoplasmic Membrane Score: 0.05
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.102
    • Ymax_pos: 11
    • Cmax: 0.108
    • Cmax_pos: 24
    • Smax: 0.152
    • Smax_pos: 1
    • Smean: 0.092
    • D: 0.098
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MDTAGIRLTPKEIVSKLNEYIVGQNDAKRKVAIALRNRYRRSLLDEESKQEISPKNILMIGPTGVGKTEIARRMAKVVGAPFIKVEATKFTELGYVGRDVESMVRDLVDVSVRLVKAQKKSLVQDEATAKANEKLVKLLVPSMKKKASQTNNPLESLFGGAIPNFGQNNEDEEEPPTEEIKTKRSEIKRQLEEGKLEKEKVRIKVEQDPGALGMLGTNQNQQMQEMMNQLMPKKKVEREVAVETARKILADSYADELIDQESANQEALELAEQMGIIFIDEIDKVATNNHNSGQDVSRQGVQRDILPILEGSVIQTKYGTVNTEHMLFIGAGAFHVSKPSDLIPELQGRFPIRVELDSLSVEDFVRILTEPKLSLIKQYEALLQTEEVTVNFTDEAITRLAEIAYQVNQDTDNIGARRLHTILEKMLEDLSFEAPSMPNAVVDITPQYVDDKLKSISTNKDLSAFIL

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 1.49

Relevant publications[edit source | edit]