From AureoWiki
Jump to: navigation, search

NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS02590 [old locus tag: SA0449 ]
  • pan locus tag?: SAUPAN002228000
  • symbol: SA_RS02590
  • pan gene symbol?:
  • synonym:
  • product: TatD family deoxyribonuclease

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA_RS02590 [old locus tag: SA0449 ]
  • symbol: SA_RS02590
  • product: TatD family deoxyribonuclease
  • replicon: chromosome
  • strand: +
  • coordinates: 521192..521965
  • length: 774
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002745 (521192..521965) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGTTAATCGATACACATGTCCATTTAAATGATGAGCAATACGATGATGATTTGAGTGAA
    GTGATTACACGTGCTAGAGAAGCAGGTGTTGATCGTATGTTTGTAGTTGGTTTTAACAAA
    TCGACAATTGAACGCGCGATGAAATTAATCGATGAGTATGATTTTTTATATGGCATTATC
    GGTTGGCATCCAGTTGACGCAATTGATTTTACAGAAGAACACCTGGAATGGATTGAATCT
    TTAGCTCAGCATCCAAAAGTGATTGGTATTGGTGAAATGGGATTAGATTATCACTGGGAT
    AAATCTCCTGCAGATGTTCAAAAGGAAGTTTTTAGAAAGCAAATTGCTTTAGCTAAGCGT
    TTGAAGTTACCAATTATCATTCATAACCGTGAAGCAACTCAAGACTGTATCGATATCTTA
    TTAGAGGAGCATGCTGAAGAGGTAGGCGGGATTATGCATAGCTTTAGTGGTTCTCCAGAA
    ATTGCAGATATTGTAACTAATAAGCTGAATTTTTATATTTCATTAGGTGGACCTGTGACA
    TTTAAAAATGCTAAACAGCCTAAAGAAGTTGCTAAGCATGTGTCAATGGAGCGTTTGCTA
    GTTGAAACCGATGCACCGTATCTCTCGCCACATCCGTATAGAGGGAAGCGAAATGAACCG
    GCGAGAGTAACTTTAGTAGCTGAACAAATTGCTGAATTAAAAGGCTTATCTTATGAAGAA
    GTGTGCGAACAAACAACTAAAAATGCAGAGAAATTGTTTAATTTAAATTCATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    774

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA_RS02590 [old locus tag: SA0449 ]
  • symbol: SA_RS02590
  • description: TatD family deoxyribonuclease
  • length: 257
  • theoretical pI: 4.90143
  • theoretical MW: 29281.1
  • GRAVY: -0.350584

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Unknown functionEnzymes of unknown specificityhydrolase, TatD family (TIGR00010; HMM-score: 304)
  • TheSEED:
  • PFAM:
    Amidohydrolase (CL0034) TatD_DNase; TatD related DNase (PF01026; HMM-score: 279)
    Amidohydro_2; Amidohydrolase (PF04909; HMM-score: 20.7)
    Amidohydro_1; Amidohydrolase family (PF01979; HMM-score: 18.5)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA_RS01275formate acetyltransferase  [1] (data from MRSA252)
    SA_RS01365L-lactate dehydrogenase  [1] (data from MRSA252)
    SA_RS0291050S ribosomal protein L1  [1] (data from MRSA252)
    SA_RS0291550S ribosomal protein L10  [1] (data from MRSA252)
    SA_RS02955elongation factor G  [1] (data from MRSA252)
    SA_RS02960elongation factor Tu  [1] (data from MRSA252)
    SA_RS04140aldehyde dehydrogenase  [1] (data from MRSA252)
    SA_RS04575NADH dehydrogenase  [1] (data from MRSA252)
    SA_RS04710hypothetical protein  [1] (data from MRSA252)
    SA_RS05350pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SA_RS05365dihydrolipoyl dehydrogenase  [1] (data from MRSA252)
    SA_RS0622530S ribosomal protein S2  [1] (data from MRSA252)
    SA_RS06490glutamine synthetase  [1] (data from MRSA252)
    SA_RS07060dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex  [1] (data from MRSA252)
    SA_RS08545isocitrate dehydrogenase (NADP(+))  [1] (data from MRSA252)
    SA_RS11430Asp23/Gls24 family envelope stress response protein  [1] (data from MRSA252)
    SA_RS1168030S ribosomal protein S5  [1] (data from MRSA252)
    SA_RS1169050S ribosomal protein L6  [1] (data from MRSA252)
    SA_RS1174050S ribosomal protein L22  [1] (data from MRSA252)
    SA_RS1176050S ribosomal protein L4  [1] (data from MRSA252)
    SA_RS13735malate:quinone oxidoreductase  [1] (data from MRSA252)
    SA_RS13920arginine deiminase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.083
    • Ymax_pos: 46
    • Cmax: 0.118
    • Cmax_pos: 68
    • Smax: 0.099
    • Smax_pos: 45
    • Smean: 0.057
    • D: 0.073
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446827056 NCBI
  • RefSeq: WP_000904312 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MLIDTHVHLNDEQYDDDLSEVITRAREAGVDRMFVVGFNKSTIERAMKLIDEYDFLYGIIGWHPVDAIDFTEEHLEWIESLAQHPKVIGIGEMGLDYHWDKSPADVQKEVFRKQIALAKRLKLPIIIHNREATQDCIDILLEEHAEEVGGIMHSFSGSPEIADIVTNKLNFYISLGGPVTFKNAKQPKEVAKHVSMERLLVETDAPYLSPHPYRGKRNEPARVTLVAEQIAELKGLSYEEVCEQTTKNAEKLFNLNS

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA_RS02590 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]