From AureoWiki
Jump to: navigation, search

NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS03435 [old locus tag: SA0598 ]
  • pan locus tag?: SAUPAN002519000
  • symbol: SA_RS03435
  • pan gene symbol?: pbp4
  • synonym:
  • product: D-alanyl-D-alanine carboxypeptidase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA_RS03435 [old locus tag: SA0598 ]
  • symbol: SA_RS03435
  • product: D-alanyl-D-alanine carboxypeptidase
  • replicon: chromosome
  • strand: -
  • coordinates: 690688..691983
  • length: 1296
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002745 (690688..691983) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    ATGAAAAATTTAATATCTATTATCATCATTTTATGTTTAACATTAAGTATTATGACACCA
    TATGCACAAGCTACTAACAGTGACGTAACCCCTGTACAAGCAGCAAATCAATATGGTTAT
    GCAGGTTTGTCGGCTGCATACGAACCGACGAGTGCTGTTAATGTAAGTCAAACTGGACAA
    TTACTGTATCAATACAATATCGATACTAAGTGGAATCCAGCGTCTATGACTAAATTAATG
    ACAATGTACTTAACATTGGAAGCTGTAAATAAGGGGCAGCTTTCACTTGATGACACAGTC
    ACAATGACGAACAAAGAATATATTATGTCTACACTACCTGAGTTGAGTAATACGAAACTA
    TATCCTGGACAAGTATGGACAATCGCAGACCTATTACAAATTACAGTATCTAATTCTAGT
    AATGCCGCGGCATTAATTTTAGCTAAGAAGGTATCAAAAAACACCAGCGATTTCGTTGAT
    TTAATGAATAACAAAGCTAAAGCTATCGGAATGAAAAATACACATTTCGTCAATCCAACG
    GGTGCTGAAAATTCAAGATTACGTTCATTTGCACCAACAAAGTATAAAGACCAAGAACGT
    ACTGTAACGACTGCTAGAGACTATGCCATTTTAGATTTACACGTGATTAAAGAGACACCT
    AAAATATTAGACTTTACAAAGCAGTTAGCACCAACAACGCATGCAGTTACGTATTACACA
    TTCAACTTTTCATTGGAAGGTGCAAAAATGAGTTTGCCTGGTACAGATGGTTTAAAAACT
    GGATCAAGTGATACAGCAAATTACAACCATACGATTACTACCAAACGAGGTAAATTTAGA
    ATTAATCAAGTTATCATGGGTGCAGGAGACTATAAAAACCTTGGTGGCGAGAAGCAACGT
    AATATGATGGGGAATGCATTAATGGAACGCTCATTTGATCAGTATAAATATGTAAAAATA
    TTGTCTAAAGGTGAGCAAAGGATAAATGGTAAGAAATATTATGTTGAAAATGATCTTTAC
    GATGTTTTACCAAGTGATTTTAGTAAAAAAGATTATAAACTTGTAGTCGAAGATGGTAAA
    GTACACGCGGACTATCCAAGAGAATTTATTAATAAAGATTATGGACCTCCAACTGTAGAA
    GTTCATCAGCCAATTATTCAAAAGGCAAATACTGTTGCTAAAAGTATGTGGGAAGAACAT
    CCATTATTCACTATCATTGGTGGTGCATGCCTTGTCGCTGGATTAGCACTTATTGTTCAT
    ATGATAATCAATCGTTTATTTAGAAAAAGAAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1296

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA_RS03435 [old locus tag: SA0598 ]
  • symbol: SA_RS03435
  • description: D-alanyl-D-alanine carboxypeptidase
  • length: 431
  • theoretical pI: 9.63301
  • theoretical MW: 48217.1
  • GRAVY: -0.305336

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
  • TheSEED:
  • PFAM:
    Beta-lactamase (CL0013) Peptidase_S11; D-alanyl-D-alanine carboxypeptidase (PF00768; HMM-score: 176.3)
    no clan definedDUF1958; Domain of unknown function (DUF1958) (PF09211; HMM-score: 104)
    Beta-lactamase (CL0013) Beta-lactamase2; Beta-lactamase enzyme family (PF13354; HMM-score: 64)
    Beta-lactamase; Beta-lactamase (PF00144; HMM-score: 37.8)
    Peptidase_S13; D-Ala-D-Ala carboxypeptidase 3 (S13) family (PF02113; HMM-score: 14.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA_RS07290(asnC)asparagine--tRNA ligase  [1] (data from MRSA252)
    SA_RS11130(deoA)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    SA_RS00690immunoglobulin G-binding protein A  [1] (data from MRSA252)
    SA_RS0201530S ribosomal protein S6  [1] (data from MRSA252)
    SA_RS0202530S ribosomal protein S18  [1] (data from MRSA252)
    SA_RS02405methionine ABC transporter substrate-binding protein  [1] (data from MRSA252)
    SA_RS0290550S ribosomal protein L11  [1] (data from MRSA252)
    SA_RS0294530S ribosomal protein S12  [1] (data from MRSA252)
    SA_RS02960elongation factor Tu  [1] (data from MRSA252)
    SA_RS04140aldehyde dehydrogenase  [1] (data from MRSA252)
    SA_RS04710hypothetical protein  [1] (data from MRSA252)
    SA_RS05295phosphocarrier protein HPr  [1] (data from MRSA252)
    SA_RS05350pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SA_RS05355pyruvate dehydrogenase E1 component subunit beta  [1] (data from MRSA252)
    SA_RS05360dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex  [1] (data from MRSA252)
    SA_RS05365dihydrolipoyl dehydrogenase  [1] (data from MRSA252)
    SA_RS05860cell division protein FtsZ  [1] (data from MRSA252)
    SA_RS0605050S ribosomal protein L28  [1] (data from MRSA252)
    SA_RS0614050S ribosomal protein L19  [1] (data from MRSA252)
    SA_RS0622530S ribosomal protein S2  [1] (data from MRSA252)
    SA_RS06490glutamine synthetase  [1] (data from MRSA252)
    SA_RS07060dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex  [1] (data from MRSA252)
    SA_RS070652-oxoglutarate dehydrogenase E1 component  [1] (data from MRSA252)
    SA_RS07385DNA-binding protein HU  [1] (data from MRSA252)
    SA_RS07955molecular chaperone DnaK  [1] (data from MRSA252)
    SA_RS0829550S ribosomal protein L21  [1] (data from MRSA252)
    SA_RS0846050S ribosomal protein L20  [1] (data from MRSA252)
    SA_RS08545isocitrate dehydrogenase (NADP(+))  [1] (data from MRSA252)
    SA_RS08560pyruvate kinase  [1] (data from MRSA252)
    SA_RS0867530S ribosomal protein S4  [1] (data from MRSA252)
    SA_RS11380hypothetical protein  [1] (data from MRSA252)
    SA_RS1160030S ribosomal protein S9  [1] (data from MRSA252)
    SA_RS1160550S ribosomal protein L13  [1] (data from MRSA252)
    SA_RS1164030S ribosomal protein S11  [1] (data from MRSA252)
    SA_RS1164530S ribosomal protein S13  [1] (data from MRSA252)
    SA_RS1167050S ribosomal protein L15  [1] (data from MRSA252)
    SA_RS1168030S ribosomal protein S5  [1] (data from MRSA252)
    SA_RS1170550S ribosomal protein L5  [1] (data from MRSA252)
    SA_RS1173530S ribosomal protein S3  [1] (data from MRSA252)
    SA_RS1174050S ribosomal protein L22  [1] (data from MRSA252)
    SA_RS1175050S ribosomal protein L2  [1] (data from MRSA252)
    SA_RS1176050S ribosomal protein L4  [1] (data from MRSA252)
    SA_RS13375hydroxymethylglutaryl-CoA synthase  [1] (data from MRSA252)
    SA_RS13705L-lactate dehydrogenase  [1] (data from MRSA252)
    SA_RS13735malate:quinone oxidoreductase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 9.68
    • Cellwall Score: 0.17
    • Extracellular Score: 0.16
    • Internal Helices: 2
  • LocateP:
  • SignalP: Signal peptide length 25 aa
    • Ymax: 0.798
    • Ymax_pos: 25
    • Cmax: 0.724
    • Cmax_pos: 25
    • Smax: 0.94
    • Smax_pos: 21
    • Smean: 0.837
    • D: 0.813
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit source | edit]

  • GI: 446715744 NCBI
  • RefSeq: WP_000793067 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MKNLISIIIILCLTLSIMTPYAQATNSDVTPVQAANQYGYAGLSAAYEPTSAVNVSQTGQLLYQYNIDTKWNPASMTKLMTMYLTLEAVNKGQLSLDDTVTMTNKEYIMSTLPELSNTKLYPGQVWTIADLLQITVSNSSNAAALILAKKVSKNTSDFVDLMNNKAKAIGMKNTHFVNPTGAENSRLRSFAPTKYKDQERTVTTARDYAILDLHVIKETPKILDFTKQLAPTTHAVTYYTFNFSLEGAKMSLPGTDGLKTGSSDTANYNHTITTKRGKFRINQVIMGAGDYKNLGGEKQRNMMGNALMERSFDQYKYVKILSKGEQRINGKKYYVENDLYDVLPSDFSKKDYKLVVEDGKVHADYPREFINKDYGPPTVEVHQPIIQKANTVAKSMWEEHPLFTIIGGACLVAGLALIVHMIINRLFRKRK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA_RS03435 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]