From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0598 [new locus tag: SA_RS03435 ]
  • pan locus tag?: SAUPAN002519000
  • symbol: pbp4
  • pan gene symbol?: pbp4
  • synonym:
  • product: penicillin binding protein 4

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA0598 [new locus tag: SA_RS03435 ]
  • symbol: pbp4
  • product: penicillin binding protein 4
  • replicon: chromosome
  • strand: -
  • coordinates: 690688..691983
  • length: 1296
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    ATGAAAAATTTAATATCTATTATCATCATTTTATGTTTAACATTAAGTATTATGACACCA
    TATGCACAAGCTACTAACAGTGACGTAACCCCTGTACAAGCAGCAAATCAATATGGTTAT
    GCAGGTTTGTCGGCTGCATACGAACCGACGAGTGCTGTTAATGTAAGTCAAACTGGACAA
    TTACTGTATCAATACAATATCGATACTAAGTGGAATCCAGCGTCTATGACTAAATTAATG
    ACAATGTACTTAACATTGGAAGCTGTAAATAAGGGGCAGCTTTCACTTGATGACACAGTC
    ACAATGACGAACAAAGAATATATTATGTCTACACTACCTGAGTTGAGTAATACGAAACTA
    TATCCTGGACAAGTATGGACAATCGCAGACCTATTACAAATTACAGTATCTAATTCTAGT
    AATGCCGCGGCATTAATTTTAGCTAAGAAGGTATCAAAAAACACCAGCGATTTCGTTGAT
    TTAATGAATAACAAAGCTAAAGCTATCGGAATGAAAAATACACATTTCGTCAATCCAACG
    GGTGCTGAAAATTCAAGATTACGTTCATTTGCACCAACAAAGTATAAAGACCAAGAACGT
    ACTGTAACGACTGCTAGAGACTATGCCATTTTAGATTTACACGTGATTAAAGAGACACCT
    AAAATATTAGACTTTACAAAGCAGTTAGCACCAACAACGCATGCAGTTACGTATTACACA
    TTCAACTTTTCATTGGAAGGTGCAAAAATGAGTTTGCCTGGTACAGATGGTTTAAAAACT
    GGATCAAGTGATACAGCAAATTACAACCATACGATTACTACCAAACGAGGTAAATTTAGA
    ATTAATCAAGTTATCATGGGTGCAGGAGACTATAAAAACCTTGGTGGCGAGAAGCAACGT
    AATATGATGGGGAATGCATTAATGGAACGCTCATTTGATCAGTATAAATATGTAAAAATA
    TTGTCTAAAGGTGAGCAAAGGATAAATGGTAAGAAATATTATGTTGAAAATGATCTTTAC
    GATGTTTTACCAAGTGATTTTAGTAAAAAAGATTATAAACTTGTAGTCGAAGATGGTAAA
    GTACACGCGGACTATCCAAGAGAATTTATTAATAAAGATTATGGACCTCCAACTGTAGAA
    GTTCATCAGCCAATTATTCAAAAGGCAAATACTGTTGCTAAAAGTATGTGGGAAGAACAT
    CCATTATTCACTATCATTGGTGGTGCATGCCTTGTCGCTGGATTAGCACTTATTGTTCAT
    ATGATAATCAATCGTTTATTTAGAAAAAGAAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1296

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA0598 [new locus tag: SA_RS03435 ]
  • symbol: Pbp4
  • description: penicillin binding protein 4
  • length: 431
  • theoretical pI: 9.63301
  • theoretical MW: 48217.1
  • GRAVY: -0.305336

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
  • TheSEED:  
    CBSS-84588.1.peg.1247 D-alanyl-D-alanine carboxypeptidase (EC 3.4.16.4) / Penicillin binding protein PBP4 
    Murein Hydrolases D-alanyl-D-alanine carboxypeptidase (EC 3.4.16.4) / Penicillin binding protein PBP4 
    Peptidoglycan Biosynthesis D-alanyl-D-alanine carboxypeptidase (EC 3.4.16.4) / Penicillin binding protein PBP4 
  • PFAM:
    Beta-lactamase (CL0013) Peptidase_S11; D-alanyl-D-alanine carboxypeptidase (PF00768; HMM-score: 176.3)
    no clan definedDUF1958; Domain of unknown function (DUF1958) (PF09211; HMM-score: 104)
    Beta-lactamase (CL0013) Beta-lactamase2; Beta-lactamase enzyme family (PF13354; HMM-score: 64)
    Beta-lactamase; Beta-lactamase (PF00144; HMM-score: 37.8)
    Peptidase_S13; D-Ala-D-Ala carboxypeptidase 3 (S13) family (PF02113; HMM-score: 14.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA1287(asnC)asparaginyl-tRNA synthetase  [1] (data from MRSA252)
    SA1517(citC)isocitrate dehydrogenase  [1] (data from MRSA252)
    SA1409(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    SA1029(ftsZ)cell division protein FtsZ  [1] (data from MRSA252)
    SA0727(gap)glyceraldehyde-3-phosphate dehydrogenase  [1] (data from MRSA252)
    SA1150(glnA)glutamine-ammonia ligase  [1] (data from MRSA252)
    SA1305(hu)DNA-binding protein II  [1] (data from MRSA252)
    SA2400(mqo2)malate:quinone oxidoreductase  [1] (data from MRSA252)
    SA2334(mvaS)3-hydroxy-3-methylglutaryl-CoA synthase  [1] (data from MRSA252)
    SA1244(odhB)dihydrolipoamide succinyltransferase  [1] (data from MRSA252)
    SA0943-1(pdhA)pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SA0944(pdhB)pyruvate dehydrogenase E1 component subunit beta  [1] (data from MRSA252)
    SA0945(pdhC)branched-chain alpha-keto acid dehydrogenase E2 subunit  [1] (data from MRSA252)
    SA0946(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    SA1938(pdp)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    SA0934(ptsH)phosphocarrier protein HPr  [1] (data from MRSA252)
    SA1520(pykA)pyruvate kinase  [1] (data from MRSA252)
    SA2044(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    SA2046(rplD)50S ribosomal protein L4  [1] (data from MRSA252)
    SA2035(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    SA0495(rplK)50S ribosomal protein L11  [1] (data from MRSA252)
    SA2017(rplM)50S ribosomal protein L13  [1] (data from MRSA252)
    SA2029(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    SA1084(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    SA1502(rplT)50S ribosomal protein L20  [1] (data from MRSA252)
    SA1473(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    SA2042(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    SA1067(rpmB)50S ribosomal protein L28  [1] (data from MRSA252)
    SA1099(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    SA2041(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    SAS052(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    SA2031(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SA0352(rpsF)30S ribosomal protein S6  [1] (data from MRSA252)
    SA2016(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    SA2024(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    SA0503(rpsL)30S ribosomal protein S12  [1] (data from MRSA252)
    SA2025(rpsM)30S ribosomal protein S13  [1] (data from MRSA252)
    SA0354(rpsR)30S ribosomal protein S18  [1] (data from MRSA252)
    SA0107(spa)immunoglobulin G binding protein A  [1] (data from MRSA252)
    SA1245(sucA)2-oxoglutarate dehydrogenase E1  [1] (data from MRSA252)
    SA0506(tuf)elongation factor Tu  [1] (data from MRSA252)
    SA0422hypothetical protein  [1] (data from MRSA252)
    SA0829hypothetical protein  [1] (data from MRSA252)
    SA2395L-lactate dehydrogenase  [1] (data from MRSA252)
    SAS074hypothetical protein  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 9.68
    • Cellwall Score: 0.17
    • Extracellular Score: 0.16
    • Internal Helices: 2
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular Possibility: 0
    • Signal Peptide Possibility: 1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: Signal peptide length 25 aa
    • Ymax: 0.798
    • Ymax_pos: 25
    • Cmax: 0.724
    • Cmax_pos: 25
    • Smax: 0.94
    • Smax_pos: 21
    • Smean: 0.837
    • D: 0.813
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit source | edit]

  • GI: 15926319 NCBI
  • RefSeq: NP_373852 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MKNLISIIIILCLTLSIMTPYAQATNSDVTPVQAANQYGYAGLSAAYEPTSAVNVSQTGQLLYQYNIDTKWNPASMTKLMTMYLTLEAVNKGQLSLDDTVTMTNKEYIMSTLPELSNTKLYPGQVWTIADLLQITVSNSSNAAALILAKKVSKNTSDFVDLMNNKAKAIGMKNTHFVNPTGAENSRLRSFAPTKYKDQERTVTTARDYAILDLHVIKETPKILDFTKQLAPTTHAVTYYTFNFSLEGAKMSLPGTDGLKTGSSDTANYNHTITTKRGKFRINQVIMGAGDYKNLGGEKQRNMMGNALMERSFDQYKYVKILSKGEQRINGKKYYVENDLYDVLPSDFSKKDYKLVVEDGKVHADYPREFINKDYGPPTVEVHQPIIQKANTVAKSMWEEHPLFTIIGGACLVAGLALIVHMIINRLFRKRK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • pbp4 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44

Relevant publications[edit source | edit]