From AureoWiki
Jump to navigation Jump to search

NCBI: 06-JUL-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_1954 [new locus tag: NWMN_RS11270 ]
  • pan locus tag?: SAUPAN005292000
  • symbol: NWMN_1954
  • pan gene symbol?: vga
  • synonym:
  • product: ABC transporter ATP-binding protein

Additional information (user-provided)[edit | edit source]

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_1954 [new locus tag: NWMN_RS11270 ]
  • symbol: NWMN_1954
  • product: ABC transporter ATP-binding protein
  • replicon: chromosome
  • strand: +
  • coordinates: 2162380..2164308
  • length: 1929
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Additional information (user-provided)[edit | edit source]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    ATGATACTTTTACAACTCAATCATATATCAAAATCGTTCGATGGTGAAGATATATTTACT
    GATGTTGATTTTGAAGTAAAAACTGGTGAACGAATTGGTATCGTAGGAAGAAATGGCGCC
    GGTAAATCAACATTGATGAAAATTATAGCTGGCGTAGAAAACTATGATTCTGGAAATGTG
    TCAAAAATTAAAAACTTAAAACTAGGTTATTTAACTCAACAAATGACTTTAAATTCTAAT
    GCAACAGTTTTTGAAGAAATGTCAAAACCATTTGAACATATTAAACGAATGGAAAGCTTA
    ATCAAAGAAGAAACAGATTGGTTATCAAAACATGCAAATGATTACGATAGTGATACATAT
    AAAACACATATGTCCCGTTATGAATCTTTATCGAATCAATTTGAACAATTAGAAGGATAT
    CAATATGAAAGTAAAATTAAAACAGTACTTTACGGGTTAAATTTTAGTGAAGAAGATTTC
    AATAAACCTATCAATGATTTTAGCGGTGGCCAAAAAACACGTTTATCTTTAGCTCAAATG
    CTATTAAACGAACCTGATTTATTACTTTTAGATGAACCTACTAACCACTTAGATTTAGAA
    ACGACAAAGTGGCTTGAAGATTATCTACGTTATTTTAAAGGTGCAATCGTCATCATCAGC
    CATGATCGTTACTTTTTAGATAAAATAGTTACTCAAATTTATGATGTGGCTTTAGGTGAT
    GTCAAACGCTATGTTGGTAATTACGAGGAATTTATACAGCAACGAGATTTATATTATCAA
    AAACGAATGCAAGAATATGAAAGTCAACAAGCAGAAATAAAACGATTAGAAACTTTTGTT
    GAGAAAAATATTACCCGTGCTTCAACAAGTGGAATGGCAAAAAGTAGACGTAAGATTTTA
    GAAAAAATGGAACGCATTGATAAACCAATGTTAGATGCCAAAAGTGCAAATATTCAATTT
    GGCTTTGACCGGAATACAGGTAATGACGTCATGCATGTAAAAAATTTAGAAATCGGTTAT
    CAAACTGCAATTACCAAACCTATGAGTATAGAGGTCTCTAAAGGCGATCATATAGCAATC
    ATTGGGCCAAATGGTATTGGAAAATCGACCTTAATTAAAACTATTGCTAATCAACAAAAA
    GCGCTTAATGGCGATATTACTTTCGGCGCAAATTTACAAATTGGTTATTATGATCAAAAG
    CAAGCAGAATTTAAATCTAGTAAAACGATTTTAGATTATGTGTGGGATCAATATCCGTTA
    ATGAATGAAAAAGATATTCGAGCAGTTCTTGGACGTTTCTTATTTGTACAAGACGATGTT
    AAAAAGATAATTAATGATTTATCTGGTGGTGAAAAAGCACGTTTACTACTAGCACTACTT
    ATGTTGCAACGTGACAATGTACTTATTTTAGATGAACCTACCAACCACCTCGATATAGAT
    TCAAAAGAAATGTTAGAGCAAGCACTCCAACATTTTGAAGGAACAATACTATTTGTTTCC
    CATGATCGTTACTTTATTAACCAATTAGCAAACAAGGTATTTGATTTAACAATTGATGGC
    GGAAAGATGTATTTAGGAGATTATCAATATTACATTGAAAAAGTTGAGGAAGCGGAAGCG
    TTGAAAGCGCACCAAGAAGAACAGTCAGTTAACGTACAAGCACATAAAAAGTCTATGGAA
    CAATCGTCGTATCATAACCAAAAAGAACAAAGACGTGAACAACGCAAACTTGAACGACAA
    ATATCCGAGTGTGAAAATGAAATAGAAACTTTAGAGACTACTATCTTACAAATAGACGAG
    CAATTAACCCAACCAGAAGTGTATAACAATCCACAAAAAGCAAACGAATTAGCTATCCAA
    AAACAAGATAGCGAACAAAAATTAGAACACGCTATGTCTAAATGGGAAGAATTACAACAA
    AAACTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1929


Protein[edit | edit source]

General[edit | edit source]

  • locus tag: NWMN_1954 [new locus tag: NWMN_RS11270 ]
  • symbol: NWMN_1954
  • description: ABC transporter ATP-binding protein
  • length: 642
  • theoretical pI: 5.07123
  • theoretical MW: 74445.7
  • GRAVY: -0.638474

Function[edit | edit source]

  • TIGRFAM:
    ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 390.8)
    and 95 more
    Cellular processes Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 172.2)
    Metabolism Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 172.2)
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 159.1)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 152.3)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 147.6)
    Metabolism Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 147.6)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 143)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 142.6)
    Metabolism Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 140.9)
    Cellular processes Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 139.8)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 139.8)
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 139.2)
    Cellular processes Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 135.6)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 134.7)
    lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 134.5)
    Metabolism Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 133.6)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 131.3)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 129.7)
    Metabolism Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 128.9)
    Metabolism Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 127.8)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 127.1)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 126.7)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 126.7)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 125.9)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 125.9)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 125.8)
    Metabolism Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 120)
    Metabolism Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 119.2)
    Metabolism Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 116.9)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 116.1)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 113.6)
    Metabolism Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 113.2)
    gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 112.3)
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 111.8)
    Cellular processes Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 111.6)
    Metabolism Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 111.6)
    Metabolism Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 111.4)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 107.4)
    Genetic information processing Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 107.4)
    Metabolism Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 107.4)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 106.4)
    Metabolism Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 105)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 102.7)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 100.2)
    Metabolism Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 100.2)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 98.7)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 98.4)
    Metabolism Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 98.4)
    Metabolism Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 98.2)
    Metabolism Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 98.2)
    Metabolism Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 97.8)
    ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 96.8)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 95.4)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 89.4)
    ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 87.6)
    Metabolism Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 85.7)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 84.8)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 83.4)
    Metabolism Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 81.7)
    Metabolism Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 77.9)
    D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 76.4)
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 69.9)
    Metabolism Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 65.8)
    Metabolism Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 58.7)
    Metabolism Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 58.7)
    Metabolism Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 56.6)
    Metabolism Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 50.9)
    Metabolism Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 50.1)
    Metabolism Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 37)
    Cellular processes Cellular processes Chemotaxis and motility flagellar protein export ATPase FliI (TIGR03496; EC 3.6.3.14; HMM-score: 26.6)
    Cellular processes Cellular processes Pathogenesis type III secretion apparatus H+-transporting two-sector ATPase (TIGR02546; EC 3.6.3.14; HMM-score: 25.9)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type III secretion apparatus H+-transporting two-sector ATPase (TIGR02546; EC 3.6.3.14; HMM-score: 25.9)
    Genetic information processing Protein synthesis Other ribosome-associated GTPase EngA (TIGR03594; HMM-score: 24.5)
    Metabolism Energy metabolism ATP-proton motive force interconversion ATPase, FliI/YscN family (TIGR01026; EC 3.6.3.14; HMM-score: 24.3)
    Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 24.1)
    Cellular processes Cellular processes Chemotaxis and motility flagellar protein export ATPase FliI (TIGR03497; EC 3.6.3.14; HMM-score: 24.1)
    flagellar protein export ATPase FliI (TIGR03498; EC 3.6.3.14; HMM-score: 23.3)
    Genetic information processing Protein synthesis Other GTP-binding protein Era (TIGR00436; HMM-score: 21.2)
    Genetic information processing Protein synthesis Other ribosome biogenesis GTP-binding protein YsxC (TIGR03598; HMM-score: 19)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair Holliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 18.5)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions cytidylate kinase (TIGR00017; EC 2.7.4.14; HMM-score: 17.9)
    Genetic information processing Protein synthesis Other Obg family GTPase CgtA (TIGR02729; HMM-score: 17.8)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pantothenate and coenzyme A dephospho-CoA kinase (TIGR00152; EC 2.7.1.24; HMM-score: 15.2)
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN (TIGR02322; HMM-score: 15.2)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type VII secretion protein EccCb (TIGR03925; HMM-score: 14.9)
    Genetic information processing Protein synthesis Translation factors ribosome small subunit-dependent GTPase A (TIGR00157; EC 3.6.-.-; HMM-score: 13.6)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA modification GTPase TrmE (TIGR00450; EC 3.6.-.-; HMM-score: 11.3)
    Genetic information processing Protein fate Protein modification and repair [FeFe] hydrogenase H-cluster maturation GTPase HydF (TIGR03918; HMM-score: 11)
    Metabolism Transport and binding proteins Amino acids, peptides and amines LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 10.8)
    Signal transduction Regulatory functions Protein interactions LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 10.8)
    Metabolism Central intermediary metabolism Nitrogen metabolism urea carboxylase (TIGR02712; EC 6.3.4.6; HMM-score: 9.9)
    putative cytidylate kinase (TIGR02173; EC 2.7.4.14; HMM-score: 9.5)
    Cellular processes Cellular processes Chemotaxis and motility flagellar biosynthesis protein FlhF (TIGR03499; HMM-score: 9.1)
    Cellular processes Cellular processes Cell division chromosome segregation protein SMC (TIGR02168; HMM-score: 3.5)
    Genetic information processing DNA metabolism Chromosome-associated proteins chromosome segregation protein SMC (TIGR02168; HMM-score: 3.5)
  • TheSEED  :
    • ABC transporter ATP-binding protein uup
    CBSS-393121.3.peg.2760  ABC transporter ATP-binding protein uup
  • PFAM:
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 169)
    and 47 more
    ABC_tran_Xtn; ABC transporter (PF12848; HMM-score: 76)
    AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 63.5)
    no clan defined ABC_tran_CTD; ABC transporter C-terminal domain (PF16326; HMM-score: 50.8)
    P-loop_NTPase (CL0023) SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 45.7)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 34.2)
    AAA_22; AAA domain (PF13401; HMM-score: 31.9)
    ATP-synt_ab; ATP synthase alpha/beta family, nucleotide-binding domain (PF00006; HMM-score: 29.9)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 28.9)
    NB-ARC; NB-ARC domain (PF00931; HMM-score: 25.9)
    NACHT; NACHT domain (PF05729; HMM-score: 25.2)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 25)
    DUF5906; Family of unknown function (DUF5906) (PF19263; HMM-score: 23.6)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 23.1)
    ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 22.3)
    Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 22.3)
    AAA_24; AAA domain (PF13479; HMM-score: 21.9)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 21.1)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 21)
    AAA_28; AAA domain (PF13521; HMM-score: 20.5)
    NTPase_1; NTPase (PF03266; HMM-score: 20.2)
    NPHP3_N; Nephrocystin 3, N-terminal (PF24883; HMM-score: 19.7)
    Dynamin_N; Dynamin family (PF00350; HMM-score: 19.2)
    AAA_30; AAA domain (PF13604; HMM-score: 19.1)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 18.2)
    AAA_33; AAA domain (PF13671; HMM-score: 17.6)
    Rad17; Rad17 P-loop domain (PF03215; HMM-score: 17.4)
    RuvB_N; Holliday junction DNA helicase RuvB P-loop domain (PF05496; HMM-score: 17.4)
    AAA_14; AAA domain (PF13173; HMM-score: 16.6)
    Cytidylate_kin; Cytidylate kinase (PF02224; HMM-score: 16.5)
    FtsK_SpoIIIE; FtsK/SpoIIIE family (PF01580; HMM-score: 16.3)
    no clan defined SL4P; Uncharacterized Strongylid L4 protein (PF17618; HMM-score: 16.2)
    P-loop_NTPase (CL0023) SbcC_Walker_B; SbcC/RAD50-like, Walker B motif (PF13558; HMM-score: 16.1)
    AAA_7; P-loop containing dynein motor region (PF12775; HMM-score: 14.8)
    MeaB; Methylmalonyl Co-A mutase-associated GTPase MeaB (PF03308; HMM-score: 14.4)
    GTP_EFTU; Elongation factor Tu GTP binding domain (PF00009; HMM-score: 13.5)
    cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 13.5)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 12.7)
    SpoIVA_ATPase; Stage IV sporulation protein A, ATPase domain (PF09547; HMM-score: 12.5)
    bpMoxR; MoxR domain in the MoxR-vWA-beta-propeller ternary systems (PF20030; HMM-score: 12.5)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 12.3)
    AAA_19; AAA domain (PF13245; HMM-score: 12.2)
    DUF87; Helicase HerA, central domain (PF01935; HMM-score: 12)
    nSTAND3; Novel STAND NTPase 3 (PF20720; HMM-score: 11.9)
    DO-GTPase2; Double-GTPase 2 (PF19993; HMM-score: 11.7)
    AAA_27; AAA domain (PF13514; HMM-score: 11.5)
    AAA_18; AAA domain (PF13238; HMM-score: 11.2)
    SRP54; SRP54-type protein, GTPase domain (PF00448; HMM-score: 7.1)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9674
    • Cytoplasmic Membrane Score: 0.0258
    • Cell wall & surface Score: 0.002
    • Extracellular Score: 0.0048
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.021608
    • TAT(Tat/SPI): 0.00242
    • LIPO(Sec/SPII): 0.000955
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Additional information (user-provided)[edit | edit source]

Protein sequence[edit | edit source]

  • MILLQLNHISKSFDGEDIFTDVDFEVKTGERIGIVGRNGAGKSTLMKIIAGVENYDSGNVSKIKNLKLGYLTQQMTLNSNATVFEEMSKPFEHIKRMESLIKEETDWLSKHANDYDSDTYKTHMSRYESLSNQFEQLEGYQYESKIKTVLYGLNFSEEDFNKPINDFSGGQKTRLSLAQMLLNEPDLLLLDEPTNHLDLETTKWLEDYLRYFKGAIVIISHDRYFLDKIVTQIYDVALGDVKRYVGNYEEFIQQRDLYYQKRMQEYESQQAEIKRLETFVEKNITRASTSGMAKSRRKILEKMERIDKPMLDAKSANIQFGFDRNTGNDVMHVKNLEIGYQTAITKPMSIEVSKGDHIAIIGPNGIGKSTLIKTIANQQKALNGDITFGANLQIGYYDQKQAEFKSSKTILDYVWDQYPLMNEKDIRAVLGRFLFVQDDVKKIINDLSGGEKARLLLALLMLQRDNVLILDEPTNHLDIDSKEMLEQALQHFEGTILFVSHDRYFINQLANKVFDLTIDGGKMYLGDYQYYIEKVEEAEALKAHQEEQSVNVQAHKKSMEQSSYHNQKEQRREQRKLERQISECENEIETLETTILQIDEQLTQPEVYNNPQKANELAIQKQDSEQKLEHAMSKWEELQQKL

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell:
  • interaction partners:
    NWMN_1587(citC)isocitrate dehydrogenase  [1] (data from MRSA252)
    NWMN_2029(fbaA)fructose-bisphosphate aldolase  [1] (data from MRSA252)
    NWMN_1096(ftsZ)cell division protein FtsZ  [1] (data from MRSA252)
    NWMN_0509(fus)elongation factor G  [1] (data from MRSA252)
    NWMN_0741(gapA)glyceraldehyde 3-phosphate dehydrogenase 1  [1] (data from MRSA252)
    NWMN_1580(gapB)glyceraldehyde 3-phosphate dehydrogenase 2  [1] (data from MRSA252)
    NWMN_1468(glyS)glycyl-tRNA synthetase  [1] (data from MRSA252)
    NWMN_1417(gnd)6-phosphogluconate dehydrogenase  [1] (data from MRSA252)
    NWMN_1178(infB)translation initiation factor IF-2  [1] (data from MRSA252)
    NWMN_2040(pdp)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    NWMN_0833(pgi)glucose-6-phosphate isomerase  [1] (data from MRSA252)
    NWMN_0742(pgk)phosphoglycerate kinase  [1] (data from MRSA252)
    NWMN_0959(phdA)pyruvate dehydrogenase E1 component, alpha subunit  [1] (data from MRSA252)
    NWMN_1592(pykA)pyruvate kinase  [1] (data from MRSA252)
    NWMN_2151(rplD)50S ribosomal protein L4  [1] (data from MRSA252)
    NWMN_2137(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    NWMN_0501(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    NWMN_1151(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    NWMN_0504(rpoB)DNA-directed RNA polymerase subunit beta  [1] (data from MRSA252)
    NWMN_1166(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    NWMN_2135(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    NWMN_2153(rpsJ)30S ribosomal protein S10  [1] (data from MRSA252)
    NWMN_2128(rpsM)30S ribosomal protein S13  [1] (data from MRSA252)
    NWMN_2143(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    NWMN_1156(sucD)succinyl-CoA synthetase subunit alpha  [1] (data from MRSA252)
    NWMN_0510(tufA)elongation factor Tu  [1] (data from MRSA252)
    NWMN_02495'-nucleotidase, lipoprotein e(P4) family protein  [1] (data from MRSA252)
    NWMN_0811hypothetical protein  [1] (data from MRSA252)
    NWMN_1604universal stress protein family protein  [1] (data from MRSA252)
    NWMN_2086alkaline shock protein 23  [1] (data from MRSA252)
    NWMN_2503fructose-1,6-bisphosphate aldolase  [1] (data from MRSA252)

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Additional information (user-provided)[edit | edit source]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Additional information (user-provided)[edit | edit source]

Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]