From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0250 [new locus tag: SACOL_RS01265 ]
  • pan locus tag?: SAUPAN001145000
  • symbol: SACOL0250
  • pan gene symbol?:
  • synonym:
  • product: PTS system, IIA component

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL0250 [new locus tag: SACOL_RS01265 ]
  • symbol: SACOL0250
  • product: PTS system, IIA component
  • replicon: chromosome
  • strand: +
  • coordinates: 290132..290923
  • length: 792
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    ATGAGCAATAAATATAAAGAACAAGCCCAAGACATTCTTACAGCTGTAGGTGGTGTCGAA
    AACATTGTTGATGCAACGTATGATACGAAGTGCATTACAATTCATATGCAACATACAATT
    CCTTCTACAGCAAATGAAGTGAAACAAATAGTTGATGTGACATCTGTAGCAGAAAATGAT
    ACGCAGTTAGTCATAAAATTAAATGGAAATGTCGATGAAGTGTATCAGCAATTACAGCGA
    TTAATTAAGAATGCTAATGTCGAAGAGAGTGAGAATACTGACAATATTAATAGTCAAGAT
    ACAAGTTATACACCTCAAGTAAAAGTAACAACACCAATTTTAGTGAAAGCACCAATCGCT
    GGTCGTCGTATTTTACTTAAAGAAGTAAGAGATTCAATTTTTAGAGAGAAAATGGTAGGT
    GAAGGCTTAGCAATCAAAGCTCATGAAGAATCCAAAGTAATCGCACCGTTCAATGGTTTA
    ATATCTATGATTGTACCAACTAAGCATGCAGTTGGTATTCAATCAGAAGACGGTGTGGAC
    ATAGTCATTCATATTGGCGTGAATACAGTTGACTTGGAAGGTAAAGGGTTCAAGTGCTTT
    GTAAAGCAAAATGATCATGTTGAAGCAGGGCAAACGTTGTTGCAATTCGACCAGCAATAT
    ATACAACAACAAGGCTACAATGCTGACGTTATTGTCGTTATTAGCAACTCTGCCGATTTA
    GGAAAAGTAGAACTGACAATGAATGAAATCATTACGACTGAAGATGTTATTTTTAAAATA
    TTTAAAAACTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    792

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL0250 [new locus tag: SACOL_RS01265 ]
  • symbol: SACOL0250
  • description: PTS system, IIA component
  • length: 263
  • theoretical pI: 4.71001
  • theoretical MW: 29136.9
  • GRAVY: -0.180608

Function[edit | edit source]

  • TIGRFAM:
    PTS system, beta-glucoside-specific IIABC component (TIGR01995; EC 2.7.1.69; HMM-score: 170.1)
    and 4 more
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids PTS system, glucose subfamily, IIA component (TIGR00830; HMM-score: 129.4)
    Signal transduction Signal transduction PTS PTS system, glucose subfamily, IIA component (TIGR00830; HMM-score: 129.4)
    PTS system, sucrose-specific IIBC component (TIGR01996; EC 2.7.1.69; HMM-score: 28.2)
    PTS system, trehalose-specific IIBC component (TIGR01992; EC 2.7.1.69; HMM-score: 28.1)
  • TheSEED:  
    Carbohydrates Aminosugars Chitin and N-acetylglucosamine utilization  PTS system, N-acetylglucosamine-specific IIA component
    and 5 more
    PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69)
    PTS system, N-acetylglucosamine-specific IIC component
    Cell Wall and Capsule Capsular and extracellular polysacchrides Sialic Acid Metabolism  PTS system, N-acetylglucosamine-specific IIA component
    PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69)
    PTS system, N-acetylglucosamine-specific IIC component
  • PFAM:
    Hybrid (CL0105) PTS_EIIA_1; phosphoenolpyruvate-dependent sugar phosphotransferase system, EIIA 1 (PF00358; HMM-score: 150.8)
    and 5 more
    Biotin_lipoyl_2; Biotin-lipoyl like (PF13533; HMM-score: 23.4)
    no clan defined PTS_EIIB; phosphotransferase system, EIIB (PF00367; HMM-score: 15.6)
    Hybrid (CL0105) Peptidase_M23; Peptidase family M23 (PF01551; HMM-score: 15)
    no clan defined TPD; Protein of unknown function TPD sequence-motif (PF14811; HMM-score: 12.9)
    Hybrid (CL0105) RnfC_N; RnfC Barrel sandwich hybrid domain (PF13375; HMM-score: 11.3)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.17
    • Cytoplasmic Membrane Score: 9.51
    • Cellwall Score: 0.16
    • Extracellular Score: 0.15
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.019603
    • TAT(Tat/SPI): 0.000565
    • LIPO(Sec/SPII): 0.001731
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MSNKYKEQAQDILTAVGGVENIVDATYDTKCITIHMQHTIPSTANEVKQIVDVTSVAENDTQLVIKLNGNVDEVYQQLQRLIKNANVEESENTDNINSQDTSYTPQVKVTTPILVKAPIAGRRILLKEVRDSIFREKMVGEGLAIKAHEESKVIAPFNGLISMIVPTKHAVGIQSEDGVDIVIHIGVNTVDLEGKGFKCFVKQNDHVEAGQTLLQFDQQYIQQQGYNADVIVVISNSADLGKVELTMNEIITTEDVIFKIFKN

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [1]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator: BglR* (repression) regulon
    BglR(TF)important in Beta-glucosides utilization; RegPrecise  

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]