From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS08370 [old locus tag: SACOL1641 ]
  • pan locus tag?: SAUPAN004171000
  • symbol: SACOL_RS08370
  • pan gene symbol?: lepA
  • synonym:
  • product: elongation factor 4

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL_RS08370 [old locus tag: SACOL1641 ]
  • symbol: SACOL_RS08370
  • product: elongation factor 4
  • replicon: chromosome
  • strand: -
  • coordinates: 1671897..1673720
  • length: 1824
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_002951 (1671897..1673720) NCBI
  • BioCyc: G1G4B-1757 BioCyc
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    ATGGATAATGAGCAACGCTTAAAAAGAAGAGAGAATATAAGGAATTTCTCGATTATAGCA
    CATATTGACCACGGAAAATCTACATTGGCTGATAGAATTTTAGAAAATACCAAATCAGTT
    GAAACAAGAGATATGCAAGATCAGTTACTAGATTCAATGGATTTAGAAAGAGAACGTGGT
    ATTACAATCAAATTAAACGCAGTACGTTTAAAGTACGAAGCTAAAGATGGAAATACTTAT
    ACATTCCATTTAATCGATACGCCTGGACACGTCGATTTTACATATGAAGTGTCACGTTCT
    TTGGCAGCTTGTGAGGGCGCGATTTTAGTAGTAGATGCGGCTCAAGGTATCGAAGCACAA
    ACATTAGCAAATGTTTATTTAGCATTAGATAATGAGTTAGAGTTATTGCCTGTTATTAAC
    AAAATTGATTTACCTGCTGCAGAACCTGAACGCGTGAAACAAGAAATTGAAGATATGATA
    GGTTTAGACCAAGACGATGTTGTTTTAGCAAGTGCTAAATCTAACATTGGAATTGAAGAG
    ATACTAGAGAAAATAGTTGAAGTTGTGCCAGCTCCAGATGGTGACCCAGAAGCACCACTA
    AAAGCGTTAATATTTGATTCTGAGTATGATCCATATAGAGGGGTAATTTCATCGATAAGA
    ATTGTGGACGGTGTTGTTAAAGCCGGAGATAAAATTCGAATGATGGCCACTGGTAAAGAG
    TTCGAAGTAACAGAAGTTGGAATTAATACACCTAAGCAGCTTCCAGTTGATGAATTAACA
    GTTGGTGATGTTGGTTATATTATTGCAAGTATTAAAAATGTTGATGATTCTAGGGTTGGT
    GACACCATCACATTAGCTAGTAGACCTGCATCAGAACCATTGCAAGGTTATAAGAAAATG
    AATCCAATGGTATATTGCGGACTGTTCCCAATAGATAACAAAAATTATAATGATTTAAGA
    GAAGCATTAGAAAAATTACAATTGAATGATGCATCATTAGAATTTGAGCCTGAATCGTCA
    CAAGCATTAGGTTTTGGTTATAGAACTGGTTTCTTAGGTATGTTACACATGGAAATAATT
    CAAGAAAGAATTGAAAGAGAATTTGGTATTGAATTAATTGCAACTGCACCATCTGTAATT
    TATCAATGTGTTTTAAGGGACGGTTCAGAAGTGACGGTTGATAACCCAGCACAAATGCCA
    GATCGTGATAAAATTGATAAAATATTTGAGCCATATGTTCGTGCAACTATGATGGTTCCA
    AATGACTATGTCGGTGCAGTAATGGAATTATGTCAACGTAAACGTGGACAATTTATAAAT
    ATGGACTATTTAGATGATATTCGTGTAAATATTGTTTATGAATTACCTTTAGCTGAAGTT
    GTATTTGATTTCTTCGATCAACTTAAATCTAATACTAAAGGATATGCATCATTTGATTAT
    GAATTCATCGAAAATAAAGAAAGTAATTTAGTCAAGATGGATATTTTATTAAATGGTGAT
    AAAGTGGATGCGCTAAGCTTCATAGTTCATAGAGATTTTGCATATGAACGTGGTAAAGCA
    TTAGTTGAAAAACTTAAAACGTTAATTCCAAGACAGCAATTTGAAGTACCTGTACAGGCT
    GCAATAGGACAAAAAATTGTAGCGCGTACAAATATTAAATCAATGGGTAAAAACGTTTTA
    GCTAAATGTTATGGCGGTGACATAAGCCGTAAACGTAAATTACTTGAAAAACAAAAAGCA
    GGTAAAGCTAAGATGAAAGCAGTTGGTAATGTTGAAATTCCACAAGATGCTTTCTTGGCT
    GTATTGAAAATGGATGATGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1824

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL_RS08370 [old locus tag: SACOL1641 ]
  • symbol: SACOL_RS08370
  • description: elongation factor 4
  • length: 607
  • theoretical pI: 4.59347
  • theoretical MW: 68174.6
  • GRAVY: -0.259473

Function[edit | edit source]

  • reaction:
    EC 3.6.5.n1?  ExPASy
    Elongation factor 4 GTP + H2O = GDP + phosphate
  • TIGRFAM:
    Unknown function General elongation factor 4 (TIGR01393; EC 3.6.5.-; HMM-score: 1014.8)
    and 20 more
    Cellular processes Cellular processes Adaptations to atypical conditions GTP-binding protein TypA/BipA (TIGR01394; HMM-score: 216.6)
    Genetic information processing Protein synthesis Translation factors GTP-binding protein TypA/BipA (TIGR01394; HMM-score: 216.6)
    Signal transduction Regulatory functions Other GTP-binding protein TypA/BipA (TIGR01394; HMM-score: 216.6)
    Genetic information processing Protein synthesis Translation factors translation elongation factor G (TIGR00484; HMM-score: 199.5)
    Genetic information processing Protein synthesis Translation factors translation elongation factor aEF-2 (TIGR00490; HMM-score: 179.8)
    Genetic information processing Protein synthesis Translation factors peptide chain release factor 3 (TIGR00503; HMM-score: 98.5)
    Genetic information processing Protein synthesis Translation factors translation initiation factor IF-2 (TIGR00487; HMM-score: 87.1)
    Genetic information processing Protein synthesis Translation factors translation elongation factor Tu (TIGR00485; HMM-score: 74.3)
    Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 72)
    Genetic information processing Protein synthesis Translation factors selenocysteine-specific translation elongation factor (TIGR00475; HMM-score: 68.1)
    Genetic information processing Protein synthesis Translation factors translation elongation factor EF-1, subunit alpha (TIGR00483; HMM-score: 56.4)
    Metabolism Central intermediary metabolism Sulfur metabolism sulfate adenylyltransferase, large subunit (TIGR02034; EC 2.7.7.4; HMM-score: 54.7)
    translation initiation factor 2, gamma subunit (TIGR03680; HMM-score: 42.8)
    Genetic information processing Protein synthesis Translation factors translation initiation factor aIF-2 (TIGR00491; HMM-score: 36.9)
    Genetic information processing Protein synthesis Other ribosome-associated GTPase EngA (TIGR03594; HMM-score: 33.9)
    Genetic information processing Protein fate Protein modification and repair [FeFe] hydrogenase H-cluster maturation GTPase HydF (TIGR03918; HMM-score: 20.2)
    Unknown function General GTP-binding protein HflX (TIGR03156; HMM-score: 19.1)
    Metabolism Energy metabolism Amino acids and amines ethanolamine utilization protein, EutP (TIGR02528; HMM-score: 18.8)
    Genetic information processing Protein synthesis Other ribosome biogenesis GTPase YqeH (TIGR03597; HMM-score: 17.2)
    Genetic information processing Protein synthesis Other ribosome biogenesis GTP-binding protein YsxC (TIGR03598; HMM-score: 16)
  • TheSEED:
  • PFAM:
    P-loop_NTPase (CL0023) GTP_EFTU; Elongation factor Tu GTP binding domain (PF00009; HMM-score: 181.8)
    no clan defined LepA_C; GTP-binding protein LepA C-terminus (PF06421; HMM-score: 166.3)
    and 10 more
    EF-G_C (CL0437) EFG_C; Elongation factor G C-terminus (PF00679; HMM-score: 82.8)
    EFTPs (CL0575) GTP_EFTU_D2; Elongation factor Tu domain 2 (PF03144; HMM-score: 51.6)
    EF-G_C (CL0437) EFG_II; Elongation Factor G, domain II (PF14492; HMM-score: 25.6)
    P-loop_NTPase (CL0023) MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 23.2)
    Ras; Ras family (PF00071; HMM-score: 19.3)
    SRPRB; Signal recognition particle receptor beta subunit (PF09439; HMM-score: 16.2)
    PduV-EutP; Ethanolamine utilisation - propanediol utilisation (PF10662; HMM-score: 15.6)
    no clan defined MMR_HSR1_Xtn; C-terminal region of MMR_HSR1 domain (PF16897; HMM-score: 15.6)
    Adeno_E3_15_3; Adenovirus 15.3kD protein in E3 region (PF03307; HMM-score: 15.5)
    EF-G_C (CL0437) RF3_C; Class II release factor RF3, C-terminal domain (PF16658; HMM-score: 15.4)

Structure, modifications & interactions[edit | edit source]

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 1.05
    • Cytoplasmic Membrane Score: 8.78
    • Cellwall Score: 0.08
    • Extracellular Score: 0.09
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.005084
    • TAT(Tat/SPI): 0.000787
    • LIPO(Sec/SPII): 0.000635
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 446290486 NCBI
  • RefSeq: WP_000368341 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MDNEQRLKRRENIRNFSIIAHIDHGKSTLADRILENTKSVETRDMQDQLLDSMDLERERGITIKLNAVRLKYEAKDGNTYTFHLIDTPGHVDFTYEVSRSLAACEGAILVVDAAQGIEAQTLANVYLALDNELELLPVINKIDLPAAEPERVKQEIEDMIGLDQDDVVLASAKSNIGIEEILEKIVEVVPAPDGDPEAPLKALIFDSEYDPYRGVISSIRIVDGVVKAGDKIRMMATGKEFEVTEVGINTPKQLPVDELTVGDVGYIIASIKNVDDSRVGDTITLASRPASEPLQGYKKMNPMVYCGLFPIDNKNYNDLREALEKLQLNDASLEFEPESSQALGFGYRTGFLGMLHMEIIQERIEREFGIELIATAPSVIYQCVLRDGSEVTVDNPAQMPDRDKIDKIFEPYVRATMMVPNDYVGAVMELCQRKRGQFINMDYLDDIRVNIVYELPLAEVVFDFFDQLKSNTKGYASFDYEFIENKESNLVKMDILLNGDKVDALSFIVHRDFAYERGKALVEKLKTLIPRQQFEVPVQAAIGQKIVARTNIKSMGKNVLAKCYGGDISRKRKLLEKQKAGKAKMKAVGNVEIPQDAFLAVLKMDDE

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 1.49 1.50 1.51 1.52 1.53 1.54 1.55 1.56 1.57 1.58 1.59 1.60 1.61 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]