From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_00410
  • pan locus tag?: SAUPAN002155000
  • symbol: SAOUHSC_00410
  • pan gene symbol?: zagA
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_00410
  • symbol: SAOUHSC_00410
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 410722..411924
  • length: 1203
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    ATGGCTAAAATTCCAGTTACGGTATTAAGTGGTTATTTAGGCTCGGGGAAGACAACGTTG
    TTAAATCATATTTTACAAAATCGAGAAGGTCGACGTATCGCGGTAATTGTAAATGATATG
    AGTGAAGTAAATATCGATAAAGATCTTGTCGCAGATGGTGGGGGACTATCGCGTACAGAT
    GAAAAATTAGTCGAACTTTCTAATGGTTGTATCTGTTGTACACTTAGAGACGATTTATTA
    AAAGAAGTTGAGCGTTTAGTGAAAAAAGGTGGCATCGATCAAATTGTTATTGAGTCAACA
    GGGATTTCAGAGCCAGTACCTGTTGCACAAACTTTCTCATATATTGATGATGAACTTGGC
    ATTGATCTTACAGCGATTTGCCGTTTAGATACAATGGTTACAGTTGTGGATGCTAACCGC
    TTCGTACATGACATCAACTCAGAAGATTTATTGATGGATCGTGATCAAAGCGTTGACGAA
    ACAGATGAGCGTTCGATTGCTGATTTATTAATTGACCAAGTTGAATTTTGTGATGTATTG
    ATTATTAATAAAATTGATTTAATTAGTGAAGAAGAACTAGCGAAGTTAGAAAAAATGTTA
    AGCGCATTGCAACCGACTGCTAAAATTATTAAGACAACAAATTCTGAAGTAGATTTAAAA
    GAAGTCTTGAATACGCAGCGTTTTGATTTTGAAAAAGCGAGCGAGTCAGCAGGATGGATC
    AAAGAACTTGAGTCTGGTGGGCATGCATCGCATACACCTGAAACAGAAGAATATGGTATA
    TCATCGTTTGTATATAAACGTCGTCTACCTTTCCATGCTAAAAGGTTCAATGATTGGTTA
    GAAAGCATGCCAAATAATGTCGTTCGATCAAAAGGTATCGTATGGCTAGCACAATACAAT
    CACGTAGCATGTTTATTATCTCAAGCAGGGTCATCTTGCAATATTCATCCAGTTACATAT
    TGGGTGGCTAGTATGTCTGAAGCGCAACAAACACAAATATTAGCAGAACGTCAAGATGTC
    GCAGCTGAATGGGATCCAGAATATGGCGATCGTCATACACAATTTGTCATTATTGGTACA
    GAATTAGATGAAGAAAAATTAACAAAAGAACTCGACGCATGCTTAGTCAATGCGCAAGAA
    ATTGATGCAGATTGGCAACAATTTGAAGATCCATATCAATGGCAAATTAGACCAGCACGA
    TAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1203

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAOUHSC_00410
  • symbol: SAOUHSC_00410
  • description: hypothetical protein
  • length: 400
  • theoretical pI: 4.30301
  • theoretical MW: 45047.5
  • GRAVY: -0.2835

Function[edit | edit source]

  • TIGRFAM:
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Heme, porphyrin, and cobalamin cobalamin biosynthesis protein CobW (TIGR02475; HMM-score: 158)
    and 14 more
    Genetic information processing Protein fate Protein modification and repair hydrogenase accessory protein HypB (TIGR00073; HMM-score: 29.2)
    helicase/secretion neighborhood ATPase (TIGR03819; HMM-score: 19.7)
    Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 16.9)
    Metabolism Central intermediary metabolism Nitrogen metabolism urease accessory protein UreG (TIGR00101; HMM-score: 16.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Molybdopterin molybdopterin-guanine dinucleotide biosynthesis protein B (TIGR00176; HMM-score: 15.2)
    Genetic information processing Protein synthesis Other ribosome-associated GTPase EngA (TIGR03594; HMM-score: 14.1)
    Cellular processes Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 13.9)
    Metabolism Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 13.9)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA threonylcarbamoyl adenosine modification protein YjeE (TIGR00150; HMM-score: 13.6)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking putative secretion ATPase, PEP-CTERM locus subfamily (TIGR03015; HMM-score: 13.3)
    P-type DNA transfer ATPase VirB11 (TIGR02788; HMM-score: 13.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 13)
    Signal transduction Regulatory functions Protein interactions LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 13)
    Unknown function General GTP-binding protein HflX (TIGR03156; HMM-score: 11.3)
  • TheSEED:  
    Miscellaneous Plant-Prokaryote comparative genomics COG0523-Histidine  Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
  • PFAM:
    P-loop_NTPase (CL0023) cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 201.2)
    and 23 more
    no clan defined CobW_C; Cobalamin synthesis protein cobW C-terminal domain (PF07683; HMM-score: 93.7)
    P-loop_NTPase (CL0023) RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 24.1)
    PspA (CL0235) Snf7; Snf7 (PF03357; HMM-score: 19.5)
    P-loop_NTPase (CL0023) GTP_EFTU; Elongation factor Tu GTP binding domain (PF00009; HMM-score: 19)
    T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 18.2)
    AAA_23; AAA domain (PF13476; HMM-score: 17.8)
    ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 17.2)
    no clan defined MMR_HSR1_Xtn; C-terminal region of MMR_HSR1 domain (PF16897; HMM-score: 17.1)
    P-loop_NTPase (CL0023) AAA_16; AAA ATPase domain (PF13191; HMM-score: 16.5)
    MobB; Molybdopterin guanine dinucleotide synthesis protein B (PF03205; HMM-score: 15.5)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 14.3)
    AAA_18; AAA domain (PF13238; HMM-score: 14)
    ArgK; ArgK protein (PF03308; HMM-score: 13.9)
    NACHT; NACHT domain (PF05729; HMM-score: 13.4)
    ATP_bind_1; Conserved hypothetical ATP binding protein (PF03029; HMM-score: 13.2)
    AAA_33; AAA domain (PF13671; HMM-score: 13.1)
    ABC_tran; ABC transporter (PF00005; HMM-score: 12.9)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 12.8)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 12.3)
    AAA_22; AAA domain (PF13401; HMM-score: 12.3)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 12)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 11.8)
    Zeta_toxin; Zeta toxin (PF06414; HMM-score: 11.4)

Structure, modifications & interactions[edit | edit source]

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.008153
    • TAT(Tat/SPI): 0.000308
    • LIPO(Sec/SPII): 0.002284
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MAKIPVTVLSGYLGSGKTTLLNHILQNREGRRIAVIVNDMSEVNIDKDLVADGGGLSRTDEKLVELSNGCICCTLRDDLLKEVERLVKKGGIDQIVIESTGISEPVPVAQTFSYIDDELGIDLTAICRLDTMVTVVDANRFVHDINSEDLLMDRDQSVDETDERSIADLLIDQVEFCDVLIINKIDLISEEELAKLEKMLSALQPTAKIIKTTNSEVDLKEVLNTQRFDFEKASESAGWIKELESGGHASHTPETEEYGISSFVYKRRLPFHAKRFNDWLESMPNNVVRSKGIVWLAQYNHVACLLSQAGSSCNIHPVTYWVASMSEAQQTQILAERQDVAAEWDPEYGDRHTQFVIIGTELDEEKLTKELDACLVNAQEIDADWQQFEDPYQWQIRPAR

Experimental data[edit | edit source]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

  • SAOUHSC_00410 no polycistronic organisation predicted

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  2. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  3. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  4. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]