From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_01709
  • pan locus tag?: SAUPAN004200000
  • symbol: SAOUHSC_01709
  • pan gene symbol?:
  • synonym:
  • product: acetyl-CoA carboxylase biotin carboxylase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_01709
  • symbol: SAOUHSC_01709
  • product: acetyl-CoA carboxylase biotin carboxylase
  • replicon: chromosome
  • strand: -
  • coordinates: 1616039..1617400
  • length: 1362
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    ATGCTTCGTTGTTTAATTGCGAACAGAGGTGAAATTGCTGTAAGGATTATAAGAGCTTGC
    AGAGAATATGGGATTGAAACTGTAGCAGTTTATGCAAAAGGGGACGAGCAAAGCTTGCAT
    GTACATTTAGCAGATCAAGCTATATGTATTGGGGAAGCTAATGCTTTAGATAGTTATTTA
    AATATTGACCGCATCATATCTGCTGCACAAATCACTGGTGCTAATGCAATTCACCCAGGA
    TATGGCTTTTTATCAGAATCAACAAAATTTGCTCAAACCGTTGAGGAACAAGGCATAGCG
    TTTATAGGGCCTACTAAAAAAACGATGGAAATGATGGGGGATAAAATAACAGCAAGACAA
    ACAGTTCATCATGCAGGTGTTCCTGTGATTCCAGGATCAAATGGTGCTGTGAATCATGTG
    TCTGAAATTGAGAATCTTGCCAAAGACATCGGTTATCCAGTTGTTATCAAAGCTGCCAGT
    GGCGGTGGTGGTAAAGGTATACGTATTGTAAAGAAAGCTGAAGATTTAGAAAAGGCATTT
    AAAGAAGCTAAAAGTGAAGGAAAAAAATACTTTGATGATGATCGTGTTTATGTTGAGGCT
    TTTATACCTGTTGCAAAACATGTTGAAGTTCAAGTTATGGGAGATGGGCAGGATAATTAT
    GTACATTTAGGGGAACGTGATTGTTCTGTACAACGTAAAAATCAAAAATTAATCGAAGAA
    TCTCCTTGTGCAGCATTAACTGAAGAAAGACGACAACAAATATGTAACGATGCTGTTAAA
    GTTGCACGTGCAGCAAATTATAGAAGTGCAGGTACGATTGAATTTTTAGTAACTGATACC
    GCACATTACTTTATTGAAATGAATGCTCGAATACAAGTTGAACATACTGTTACAGAGATG
    CGAGCAGAACGTGATTTGGTTGCAGCACAACTGTATTTATTGGAACATAATCATTTACCT
    TTTTCACAAAGCGATATTCAATTTAATGGTCATGTGATAGAAGCGAGAATAAATGCCGAA
    AATCCTGAAAAGAAATTTCAACCAACACCAGGTAAAGTGACAGCGTTACATTTACCTCAA
    GGCTTTAATGTGCGAGTCGATTCTTTACTATATCACGGTTATCAAGTTTCACCATATTAT
    GATTCTTTAGTAGCTAAAGTAATTGTAAAATCTCATGATAGAGCTTCAGCAATTGATAAG
    TTGAAAGTCACCTTAGATGAAATGGTGATAGATGGATTTTCTACAACTGCCGATTTTTTA
    TATGCAGTTTTAAATTATCCACTATATCGTGATGGAGATGCAAAAGATGTTGATATTAAA
    TTTTTAGAAAAACATCAAATTGTTAAAGGGGTGGAATTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1362

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAOUHSC_01709
  • symbol: SAOUHSC_01709
  • description: acetyl-CoA carboxylase biotin carboxylase
  • length: 453
  • theoretical pI: 6.36863
  • theoretical MW: 50223.8
  • GRAVY: -0.237086

Function[edit | edit source]

  • reaction:
    EC 6.4.1.2?  ExPASy
    Acetyl-CoA carboxylase ATP + acetyl-CoA + HCO3(-) = ADP + phosphate + malonyl-CoA
  • TIGRFAM:
    Metabolism Fatty acid and phospholipid metabolism Biosynthesis acetyl-CoA carboxylase, biotin carboxylase subunit (TIGR00514; EC 6.3.4.14; HMM-score: 601.9)
    Metabolism Energy metabolism Glycolysis/gluconeogenesis pyruvate carboxylase (TIGR01235; EC 6.4.1.1; HMM-score: 508.4)
    Metabolism Central intermediary metabolism Nitrogen metabolism urea carboxylase (TIGR02712; EC 6.3.4.6; HMM-score: 502.1)
    and 11 more
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Pyrimidine ribonucleotide biosynthesis carbamoyl-phosphate synthase, large subunit (TIGR01369; EC 6.3.5.5; HMM-score: 56.1)
    Cell structure Cell envelope Biosynthesis and degradation of murein sacculus and peptidoglycan D-alanine--D-alanine ligase (TIGR01205; EC 6.3.2.4; HMM-score: 54.2)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Purine ribonucleotide biosynthesis phosphoribosylglycinamide formyltransferase 2 (TIGR01142; EC 2.1.2.-; HMM-score: 49.5)
    Cellular processes Cellular processes Biosynthesis of natural products cyanophycin synthetase (TIGR02068; EC 6.3.2.29,6.3.2.30; HMM-score: 47.5)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Purine ribonucleotide biosynthesis phosphoribosylaminoimidazole carboxylase, ATPase subunit (TIGR01161; EC 4.1.1.21; HMM-score: 43.3)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Purine ribonucleotide biosynthesis phosphoribosylamine--glycine ligase (TIGR00877; EC 6.3.4.13; HMM-score: 40.4)
    alpha-L-glutamate ligase, RimK family (TIGR00768; EC 6.3.2.-; HMM-score: 37.8)
    lysine biosynthesis enzyme LysX (TIGR02144; HMM-score: 36.1)
    alpha-L-glutamate ligase homolog (TIGR02291; HMM-score: 18.9)
    Metabolism Amino acid biosynthesis Other pyrrolysine biosynthesis protein PylC (TIGR03909; HMM-score: 16.1)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other coenzyme gamma-F420-2:alpha-L-glutamate ligase (TIGR04443; EC 6.3.2.32; HMM-score: 13.6)
  • TheSEED:  
    Allophanate hydrolase 2 and Biotin carboxylase cluster  Biotin carboxylase (EC 6.3.4.14)
  • PFAM:
    ATP-grasp (CL0179) CPSase_L_D2; Carbamoyl-phosphate synthase L chain, ATP binding domain (PF02786; HMM-score: 216.8)
    and 13 more
    PreATP-grasp (CL0483) Biotin_carb_N; Biotin carboxylase, N-terminal domain (PF00289; HMM-score: 151.7)
    Hybrid (CL0105) Biotin_carb_C; Biotin carboxylase C-terminal domain (PF02785; HMM-score: 122.4)
    ATP-grasp (CL0179) Dala_Dala_lig_C; D-ala D-ala ligase C-terminus (PF07478; HMM-score: 49.1)
    ATPgrasp_Ter; ATP-grasp in the biosynthetic pathway with Ter operon (PF15632; HMM-score: 43.9)
    ATP-grasp; ATP-grasp domain (PF02222; HMM-score: 40.1)
    ATP-grasp_3; ATP-grasp domain (PF02655; HMM-score: 36.5)
    ATPgrasp_ST; Sugar-transfer associated ATP-grasp (PF14397; HMM-score: 27.9)
    RimK; RimK-like ATP-grasp domain (PF08443; HMM-score: 21.9)
    GARS_A; Phosphoribosylglycinamide synthetase, ATP-grasp (A) domain (PF01071; HMM-score: 20.4)
    ATP-grasp_4; ATP-grasp domain (PF13535; HMM-score: 20)
    ATP-grasp_5; ATP-grasp domain (PF13549; HMM-score: 14.6)
    Chelatase (CL0043) Oxidored_nitro; Nitrogenase component 1 type Oxidoreductase (PF00148; HMM-score: 13.1)
    no clan defined DUF3906; Protein of unknown function (DUF3906) (PF13046; HMM-score: 12.7)

Structure, modifications & interactions[edit | edit source]

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.010201
    • TAT(Tat/SPI): 0.000437
    • LIPO(Sec/SPII): 0.005396
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MLRCLIANRGEIAVRIIRACREYGIETVAVYAKGDEQSLHVHLADQAICIGEANALDSYLNIDRIISAAQITGANAIHPGYGFLSESTKFAQTVEEQGIAFIGPTKKTMEMMGDKITARQTVHHAGVPVIPGSNGAVNHVSEIENLAKDIGYPVVIKAASGGGGKGIRIVKKAEDLEKAFKEAKSEGKKYFDDDRVYVEAFIPVAKHVEVQVMGDGQDNYVHLGERDCSVQRKNQKLIEESPCAALTEERRQQICNDAVKVARAANYRSAGTIEFLVTDTAHYFIEMNARIQVEHTVTEMRAERDLVAAQLYLLEHNHLPFSQSDIQFNGHVIEARINAENPEKKFQPTPGKVTALHLPQGFNVRVDSLLYHGYQVSPYYDSLVAKVIVKSHDRASAIDKLKVTLDEMVIDGFSTTADFLYAVLNYPLYRDGDAKDVDIKFLEKHQIVKGVEL

Experimental data[edit | edit source]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator: CcpA* regulon
    CcpA(TF)important in Carbon catabolism; RegPrecise    transcription unit transferred from N315 data RegPrecise  

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  2. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  3. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  4. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]