From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS02705 [old locus tag: NWMN_0473 ]
  • pan locus tag?: SAUPAN002252000
  • symbol: NWMN_RS02705
  • pan gene symbol?: ftsH
  • synonym:
  • product: zinc metalloprotease

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS02705 [old locus tag: NWMN_0473 ]
  • symbol: NWMN_RS02705
  • product: zinc metalloprotease
  • replicon: chromosome
  • strand: +
  • coordinates: 537337..539430
  • length: 2094
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (537337..539430) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    ATGCAGAAAGCTTTTCGCAATGTGCTAGTTATCGTAATAATAGGCGTTATTATTTTTGGT
    CTATTTTCATATTTAAACGGTAATGGAAATATGCCGAAACAGCTTACATATAATCAATTT
    ACTGAGAAGTTGGAAAAAGGTGACCTTAAAACTTTAGAAATCCAACCACAACAAAATGTC
    TATATGGTAAGTGGTAAAACGAAAAATGATGAAGACTATTCATCAACTATTTTATATAAC
    AACGAAAAAGAATTACAAAAAATTACTGATGCTGCTAAAAAGCAAAACGGTGTAAAATTA
    ACGATTAAAGAAGAAGAAAAACAAAGTGTCTTTGTGAGTATACTTTCAACATTAATTCCA
    GTTGTAGTCATAGCGTTATTATTTATTTTCTTCCTAAGCCAAGCACAAGGTGGCGGTAGT
    GGCGGTCGTATGATGAACTTTGGTAAATCTAAAGCAAAAATGTACGATAATAATAAACGT
    CGTGTTCGTTTCTCTGATGTAGCAGGGGCAGATGAAGAAAAACAAGAATTAATTGAAATT
    GTTGATTTCTTGAAAGATAATAAAAAATTCAAAGAAATGGGATCTAGGATTCCTAAAGGT
    GTCTTACTTGTTGGACCTCCAGGTACTGGTAAAACATTACTTGCTAGAGCGGTTGCAGGT
    GAAGCTGGCGCACCATTCTTCTCTATTAGTGGTTCAGACTTTGTAGAGATGTTTGTTGGT
    GTTGGTGCGAGCCGTGTTCGTGACTTATTCGATAATGCTAAGAAAAACGCGCCTTGTATC
    ATCTTTATCGATGAGATTGATGCTGTTGGTCGTCAACGTGGTGCAGGTGTTGGTGGCGGT
    CATGATGAACGTGAACAAACCCTAAACCAATTATTAGTTGAAATGGATGGTTTCGGTGAA
    AATGAAGGTATCATTATGATAGCTGCTACAAACCGTCCTGATATCCTTGACCCAGCCTTA
    TTACGTCCAGGTCGTTTTGATAGACAAATTCAAGTTGGTCGTCCAGATGTGAAAGGCCGT
    GAAGCAATTCTTCATGTTCATGCTAAAAACAAACCACTTGATGAAACGGTTGATTTAAAA
    GCAATTTCACAACGTACACCTGGTTTCTCAGGTGCTGATTTAGAGAACTTATTAAATGAA
    GCATCTTTAATTGCTGTACGTGAAGGTAAAAAGAAAATTGACATGAGAGATATCGAAGAG
    GCAACGGATAGAGTTATAGCCGGACCTGCTAAGAAATCTCGAGTTATTTCTAAGAAAGAA
    CGTAATATTGTTGCTCATCACGAAGCTGGTCATACAATTATCGGTATGGTACTTGATGAG
    GCAGAAGTAGTGCATAAAGTTACTATTGTTCCACGTGGACAAGCAGGTGGTTATGCAATG
    ATGCTACCTAAACAAGATCGTTTCTTAATGACTGAACAAGAGTTATTAGATAAAATCTGT
    GGTTTACTTGGTGGACGTGTATCAGAAGATATTAACTTTAACGAAGTATCAACAGGTGCT
    TCAAATGACTTCGAACGTGCAACACAAATCGCACGCTCAATGGTTACGCAATATGGTATG
    AGTAAAAAATTAGGACCATTACAGTTCGGTCATAGCAATGGTCAAGTATTCTTAGGTAAA
    GATATGCAAGGTGAGCCTAATTATTCAAGCCAAATCGCATATGAAATTGATAAAGAAGTT
    CAACGAATCGTTAAAGAACAATACGAACGTTGTAAACAAATTTTATTAGAGCACAAAGAA
    CAATTAATTTTAATTGCTGAAACATTATTAACAGAAGAAACATTAGTTGCTGAACAAATT
    CAATCATTATTCTACGAAGGTAAATTACCTGAAATTGATTATGATGCAGCTAAAGTTGTT
    AAAGATGAAGATTCTGAATTTAATGATGGTAAATTCGGTAAATCTTATGAAGAGATTCGT
    AAAGAGCAATTAGAAGATGGACAACGTGACGAAAGTGAAGATCGTAAAGAAGAAAAAGAT
    ATTGCTGAGGATAAAAAAGAAGCTGATAAATCTGATGAAAAAGATGAACCAGCACATCAA
    CAAGCCCCAAATATCGAAAAACCTTACGATCCAAATCACCCAGACAATAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2094

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS02705 [old locus tag: NWMN_0473 ]
  • symbol: NWMN_RS02705
  • description: zinc metalloprotease
  • length: 697
  • theoretical pI: 5.17894
  • theoretical MW: 77783.9
  • GRAVY: -0.508178

Function[edit source | edit]

  • reaction:
    EC 3.4.24.-?  ExPASy
  • TIGRFAM:
    Cellular processesCellular processesCell divisionATP-dependent metallopeptidase HflB (TIGR01241; EC 3.4.24.-; HMM-score: 791.5)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent metallopeptidase HflB (TIGR01241; EC 3.4.24.-; HMM-score: 791.5)
    26S proteasome subunit P45 family (TIGR01242; HMM-score: 273.6)
    AAA family ATPase, CDC48 subfamily (TIGR01243; HMM-score: 259.8)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesproteasome ATPase (TIGR03689; EC 3.6.4.8; HMM-score: 143.2)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype VII secretion AAA-ATPase EccA (TIGR03922; HMM-score: 28.8)
    Genetic information processingProtein fateProtein folding and stabilizationATP-dependent protease HslVU, ATPase subunit (TIGR00390; HMM-score: 26.8)
    Cellular processesCellular processesSporulation and germinationstage V sporulation protein K (TIGR02881; HMM-score: 23.5)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 23.2)
    Genetic information processingProtein fateProtein folding and stabilizationATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 23.2)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesendopeptidase La (TIGR00763; EC 3.4.21.53; HMM-score: 21.1)
    Cellular processesCellular processesSporulation and germinationATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 21)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 21)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairHolliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 20.7)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairorc1/cdc6 family replication initiation protein (TIGR02928; HMM-score: 17.2)
    Cellular processesCellular processesOthergas vesicle protein GvpN (TIGR02640; HMM-score: 15.7)
    Unknown functionGeneralMg chelatase-like protein (TIGR00368; HMM-score: 13.7)
    putative cytidylate kinase (TIGR02173; EC 2.7.4.14; HMM-score: 13)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA polymerase III, delta' subunit (TIGR00678; EC 2.7.7.7; HMM-score: 12)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingpreprotein translocase, YajC subunit (TIGR00739; HMM-score: 11)
    MAST domain (TIGR04204; HMM-score: 9)
  • TheSEED:
  • PFAM:
    Peptidase_MA (CL0126) Peptidase_M41; Peptidase family M41 (PF01434; HMM-score: 279.8)
    P-loop_NTPase (CL0023) AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 158.6)
    no clan definedFtsH_ext; FtsH Extracellular (PF06480; HMM-score: 52.9)
    P-loop_NTPase (CL0023) AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 23.6)
    AAA_22; AAA domain (PF13401; HMM-score: 23.3)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 22.6)
    TIP49; TIP49 C-terminus (PF06068; HMM-score: 20.7)
    RuvB_N; Holliday junction DNA helicase ruvB N-terminus (PF05496; HMM-score: 20)
    AAA_33; AAA domain (PF13671; HMM-score: 17.8)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 16.5)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 14.3)
    Zeta_toxin; Zeta toxin (PF06414; HMM-score: 13.7)
    TniB; Bacterial TniB protein (PF05621; HMM-score: 13.4)
    AAA_18; AAA domain (PF13238; HMM-score: 12.8)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 12.6)
    AAA_28; AAA domain (PF13521; HMM-score: 11.3)
    no clan definedODV-E18; Occlusion-derived virus envelope protein ODV-E18 (PF10717; HMM-score: 10.7)
    GPCR_A (CL0192) SID-1_RNA_chan; dsRNA-gated channel SID-1 (PF13965; HMM-score: 5.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: Zn2+
  • effectors:
  • protein partners:
    NWMN_RS0291550S ribosomal protein L1  [1] (data from MRSA252)
    NWMN_RS02965elongation factor Tu  [1] (data from MRSA252)
    NWMN_RS04590NADH dehydrogenase  [1] (data from MRSA252)
    NWMN_RS05380pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    NWMN_RS05385pyruvate dehydrogenase E1 component subunit beta  [1] (data from MRSA252)
    NWMN_RS05390dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex  [1] (data from MRSA252)
    NWMN_RS05395dihydrolipoyl dehydrogenase  [1] (data from MRSA252)
    NWMN_RS06210cell division protein FtsZ  [1] (data from MRSA252)
    NWMN_RS07455dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex  [1] (data from MRSA252)
    NWMN_RS074602-oxoglutarate dehydrogenase E1 component  [1] (data from MRSA252)
    NWMN_RS08350molecular chaperone DnaK  [1] (data from MRSA252)
    NWMN_RS08930pyruvate kinase  [1] (data from MRSA252)
    NWMN_RS08995universal stress protein UspA  [1] (data from MRSA252)
    NWMN_RS1234030S ribosomal protein S5  [1] (data from MRSA252)
    NWMN_RS1239530S ribosomal protein S3  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.01
    • Cytoplasmic Membrane Score: 9.99
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 2
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.197
    • Ymax_pos: 31
    • Cmax: 0.148
    • Cmax_pos: 31
    • Smax: 0.418
    • Smax_pos: 1
    • Smean: 0.292
    • D: 0.234
  • predicted transmembrane helices (TMHMM): 2

Accession numbers[edit source | edit]

  • GI: 447090631 NCBI
  • RefSeq: WP_001167887 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MQKAFRNVLVIVIIGVIIFGLFSYLNGNGNMPKQLTYNQFTEKLEKGDLKTLEIQPQQNVYMVSGKTKNDEDYSSTILYNNEKELQKITDAAKKQNGVKLTIKEEEKQSVFVSILSTLIPVVVIALLFIFFLSQAQGGGSGGRMMNFGKSKAKMYDNNKRRVRFSDVAGADEEKQELIEIVDFLKDNKKFKEMGSRIPKGVLLVGPPGTGKTLLARAVAGEAGAPFFSISGSDFVEMFVGVGASRVRDLFDNAKKNAPCIIFIDEIDAVGRQRGAGVGGGHDEREQTLNQLLVEMDGFGENEGIIMIAATNRPDILDPALLRPGRFDRQIQVGRPDVKGREAILHVHAKNKPLDETVDLKAISQRTPGFSGADLENLLNEASLIAVREGKKKIDMRDIEEATDRVIAGPAKKSRVISKKERNIVAHHEAGHTIIGMVLDEAEVVHKVTIVPRGQAGGYAMMLPKQDRFLMTEQELLDKICGLLGGRVSEDINFNEVSTGASNDFERATQIARSMVTQYGMSKKLGPLQFGHSNGQVFLGKDMQGEPNYSSQIAYEIDKEVQRIVKEQYERCKQILLEHKEQLILIAETLLTEETLVAEQIQSLFYEGKLPEIDYDAAKVVKDEDSEFNDGKFGKSYEEIRKEQLEDGQRDESEDRKEEKDIAEDKKEADKSDEKDEPAHQQAPNIEKPYDPNHPDNK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS02705 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14

Relevant publications[edit source | edit]