From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS06645 [old locus tag: NWMN_1178 ]
  • pan locus tag?: SAUPAN003570000
  • symbol: NWMN_RS06645
  • pan gene symbol?: infB
  • synonym:
  • product: translation initiation factor IF-2

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS06645 [old locus tag: NWMN_1178 ]
  • symbol: NWMN_RS06645
  • product: translation initiation factor IF-2
  • replicon: chromosome
  • strand: +
  • coordinates: 1296368..1298485
  • length: 2118
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (1296368..1298485) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    ATGAGTAAACAAAGAATTTACGAATATGCGAAAGAATTAAATCTAAAGAGTAAAGAGATT
    ATAGATGAGTTAAAAAGCATGAATATTGAGGTTTCAAATCATATGCAAGCTTTGGAAGAT
    GACCAAATTAAAGCATTAGATAAAAAGTTCAAAAAAGAACAAAAGAACGACAATAAACAA
    AGCACTCAAAATAATCACCAAAAATCAAACAATCAAAACCAAAATAAAGGGCAACAAAAA
    GATAACAAAAAGAATCAACAACAAAATAATAAAGGCAACAAAGGCAATAAAAAGAATAAT
    AGAAATAATAAGAAAAATAACAAGAATAATAAACCACAAAATCAACCAGCTGCTCCAAAA
    GAAATACCATCAAAAGTGACATATCAAGAAGGTATTACAGTAGGCGAATTTGCGGATAAA
    TTAAATGTTGAATCATCAGAAATTATCAAAAAATTATTCTTACTTGGTATTGTTGCTAAT
    ATCAATCAATCATTAAATCAAGAAACAATCGAATTAATTGCCGATGATTATGGCGTTGAG
    GTTGAAGAAGAAGTTGTGATTAATGAAGAAGACTTATCAATCTATTTCGAAGACGAAAAA
    GATGATCCAGAGGCAATTGAGAGACCAGCAGTTGTAACAATTATGGGACATGTTGACCAT
    GGTAAAACGACTTTATTAGATTCAATTCGTCATACAAAAGTTACAGCAGGTGAAGCAGGC
    GGAATCACTCAACATATTGGTGCATATCAAATTGAAAACGATGGCAAAAAAATCACTTTC
    TTAGATACACCGGGACATGCTGCATTTACAACGATGCGTGCGCGTGGTGCACAAGTAACA
    GATATTACTATTTTAGTAGTAGCAGCTGACGATGGTGTTATGCCACAAACAATTGAAGCA
    ATTAACCATGCTAAAGAAGCAGAAGTACCAATTATTGTTGCAGTAAATAAAATTGATAAA
    CCAACTTCAAATCCTGATCGAGTTATGCAAGAATTAACTGAATATGGTTTAATTCCTGAA
    GATTGGGGCGGCGAAACAATTTTCGTTCCACTTTCTGCATTAAGTGGTGATGGTATCGAC
    GATTTATTAGAAATGATAGGATTAGTTGCAGAAGTTCAAGAACTTAAAGCAAATCCTAAA
    AACCGTGCTGTTGGTACAGTTATCGAAGCTGAATTAGATAAATCACGTGGTCCTTCTGCA
    TCATTATTAGTACAAAACGGTACATTAAATGTTGGTGATGCGATTGTAGTTGGTAATACT
    TACGGCCGTATCCGTGCAATGGTTAATGACTTAGGTCAAAGAATCAAAACGGCTGGTCCA
    TCAACGCCTGTTGAAATTACAGGTATTAATGATGTGCCACAAGCTGGGGATCGCTTTGTT
    GTATTTAGTGATGAAAAACAAGCTCGTCGTATTGGTGAATCAAGACACGAAGCTAGCATT
    ATACAACAACGTCAAGAAAGTAAAAATGTTTCATTAGATAACCTGTTTGAACAAATGAAA
    CAAGGTGAAATGAAAGATTTAAACGTTATTATTAAAGGTGATGTTCAAGGTTCTGTTGAA
    GCTTTAGCTGCATCATTAATGAAAATTGATGTTGAAGGCGTAAATGTTCGTATCATTCAT
    ACAGCGGTTGGTGCAATTAATGAGTCAGACGTGACACTTGCTAATGCCTCAAATGGTATT
    ATCATTGGTTTCAATGTTCGTCCAGACAGTGGTGCAAAACGTGCTGCAGAAGCTGAAAAT
    GTTGATATGCGTTTACACAGAGTTATTTATAATGTTATCGAAGAAATTGAATCAGCGATG
    AAAGGTTTACTTGATCCAGAATTTGAAGAACAAGTTATCGGACAAGCTGAAGTTCGTCAA
    ACATTCAAAGTTTCTAAAGTTGGTACTATTGCTGGATGTTATGTTACTGAAGGTAAAATT
    ACGCGAAATGCTGGTGTACGTATTATTCGTGATGGTATTGTTCAATATGAAGGCGAATTA
    GATACACTTAAACGTTTCAAAGATGATGCTAAGGAAGTTGCAAAAGGTTATGAATGTGGT
    ATTACAATTGAAAACTACAATGACCTTAAAGAAGGCGATGTTATCGAAGCATTTGAAATG
    GTTGAAATTAAGCGTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2118

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS06645 [old locus tag: NWMN_1178 ]
  • symbol: NWMN_RS06645
  • description: translation initiation factor IF-2
  • length: 705
  • theoretical pI: 4.83577
  • theoretical MW: 77870.2
  • GRAVY: -0.534894

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein synthesisTranslation factorstranslation initiation factor IF-2 (TIGR00487; HMM-score: 908.8)
    Genetic information processingProtein synthesisTranslation factorstranslation initiation factor aIF-2 (TIGR00491; HMM-score: 171.1)
    Unknown functionGeneralsmall GTP-binding protein domain (TIGR00231; HMM-score: 135.8)
    Genetic information processingProtein synthesisTranslation factorsselenocysteine-specific translation elongation factor (TIGR00475; HMM-score: 91.2)
    Unknown functionGeneralelongation factor 4 (TIGR01393; EC 3.6.5.-; HMM-score: 73.3)
    Cellular processesCellular processesAdaptations to atypical conditionsGTP-binding protein TypA/BipA (TIGR01394; HMM-score: 65.6)
    Genetic information processingProtein synthesisTranslation factorsGTP-binding protein TypA/BipA (TIGR01394; HMM-score: 65.6)
    Signal transductionRegulatory functionsOtherGTP-binding protein TypA/BipA (TIGR01394; HMM-score: 65.6)
    Genetic information processingProtein synthesisTranslation factorstranslation elongation factor G (TIGR00484; HMM-score: 52.3)
    translation initiation factor 2, gamma subunit (TIGR03680; HMM-score: 52)
    Genetic information processingProtein synthesisTranslation factorstranslation elongation factor Tu (TIGR00485; HMM-score: 48)
    Genetic information processingProtein synthesisOtherribosome-associated GTPase EngA (TIGR03594; HMM-score: 44.8)
    MetabolismCentral intermediary metabolismSulfur metabolismsulfate adenylyltransferase, large subunit (TIGR02034; EC 2.7.7.4; HMM-score: 42.4)
    Genetic information processingProtein synthesisTranslation factorstranslation elongation factor EF-1, subunit alpha (TIGR00483; HMM-score: 42)
    Genetic information processingProtein synthesisTranslation factorspeptide chain release factor 3 (TIGR00503; HMM-score: 38.8)
    Genetic information processingProtein synthesisTranslation factorstranslation elongation factor aEF-2 (TIGR00490; HMM-score: 32.9)
    Genetic information processingProtein fateProtein modification and repair[FeFe] hydrogenase H-cluster maturation GTPase HydF (TIGR03918; HMM-score: 27.2)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsferrous iron transport protein B (TIGR00437; HMM-score: 19.6)
    Cellular processesCellular processesChemotaxis and motilityflagellar biosynthesis protein FlhF (TIGR03499; HMM-score: 11.9)
    cobaltochelatase subunit (TIGR02442; EC 6.6.1.2; HMM-score: 2.7)
  • TheSEED:
  • PFAM:
    P-loop_NTPase (CL0023) GTP_EFTU; Elongation factor Tu GTP binding domain (PF00009; HMM-score: 128.9)
    no clan definedIF-2; Translation-initiation factor 2 (PF11987; HMM-score: 128.8)
    HTH (CL0123) IF2_N; Translation initiation factor IF-2, N-terminal region (PF04760; HMM-score: 110.3)
    P-loop_NTPase (CL0023) MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 43.5)
    EFTPs (CL0575) GTP_EFTU_D2; Elongation factor Tu domain 2 (PF03144; HMM-score: 29)
    P-loop_NTPase (CL0023) FeoB_N; Ferrous iron transport protein B (PF02421; HMM-score: 25.1)
    Arf; ADP-ribosylation factor family (PF00025; HMM-score: 24.6)
    Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 17.9)
    PduV-EutP; Ethanolamine utilisation - propanediol utilisation (PF10662; HMM-score: 16)
    HSP20 (CL0190) PIH1; pre-RNA processing PIH1/Nop17 (PF08190; HMM-score: 14.3)
    SIS (CL0067) SIS_2; SIS domain (PF13580; HMM-score: 14.1)
    P-loop_NTPase (CL0023) ATP_bind_1; Conserved hypothetical ATP binding protein (PF03029; HMM-score: 13.6)
    no clan definedSpt20; Spt20 family (PF12090; HMM-score: 13.2)
    Tim54; Inner membrane protein import complex subunit Tim54 (PF11711; HMM-score: 12.2)
    Nucleocapsid-N; Nucleocapsid protein N (PF11030; HMM-score: 12)
    PDDEXK (CL0236) eIF-3_zeta; Eukaryotic translation initiation factor 3 subunit 7 (eIF-3) (PF05091; HMM-score: 11.9)
    no clan definedRP-C_C; Replication protein C C-terminal region (PF11800; HMM-score: 11.3)
    DMT (CL0184) Zip; ZIP Zinc transporter (PF02535; HMM-score: 11)
    no clan definedDDHD; DDHD domain (PF02862; HMM-score: 9.9)
    Gti1_Pac2; Gti1/Pac2 family (PF09729; HMM-score: 9)
    CDC45; CDC45-like protein (PF02724; HMM-score: 8.4)
    DUF3807; Protein of unknown function (DUF3807) (PF12720; HMM-score: 8.4)
    RRN3; RNA polymerase I specific transcription initiation factor RRN3 (PF05327; HMM-score: 6.7)
    Viral_ssRNA_CP (CL0055) TT_ORF1; TT viral orf 1 (PF02956; HMM-score: 6.6)
    no clan definedNdc1_Nup; Nucleoporin protein Ndc1-Nup (PF09531; HMM-score: 6)
    Peptidase_AD (CL0130) Presenilin; Presenilin (PF01080; HMM-score: 5.8)
    FUSC (CL0307) ALMT; Aluminium activated malate transporter (PF11744; HMM-score: 5.8)
    no clan definedGREB1; Gene regulated by oestrogen in breast cancer (PF15782; HMM-score: 3.1)

Structure, modifications & interactions[edit source | edit]

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.143
    • Ymax_pos: 11
    • Cmax: 0.142
    • Cmax_pos: 38
    • Smax: 0.271
    • Smax_pos: 3
    • Smean: 0.194
    • D: 0.163
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 445965779 NCBI
  • RefSeq: WP_000043634 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MSKQRIYEYAKELNLKSKEIIDELKSMNIEVSNHMQALEDDQIKALDKKFKKEQKNDNKQSTQNNHQKSNNQNQNKGQQKDNKKNQQQNNKGNKGNKKNNRNNKKNNKNNKPQNQPAAPKEIPSKVTYQEGITVGEFADKLNVESSEIIKKLFLLGIVANINQSLNQETIELIADDYGVEVEEEVVINEEDLSIYFEDEKDDPEAIERPAVVTIMGHVDHGKTTLLDSIRHTKVTAGEAGGITQHIGAYQIENDGKKITFLDTPGHAAFTTMRARGAQVTDITILVVAADDGVMPQTIEAINHAKEAEVPIIVAVNKIDKPTSNPDRVMQELTEYGLIPEDWGGETIFVPLSALSGDGIDDLLEMIGLVAEVQELKANPKNRAVGTVIEAELDKSRGPSASLLVQNGTLNVGDAIVVGNTYGRIRAMVNDLGQRIKTAGPSTPVEITGINDVPQAGDRFVVFSDEKQARRIGESRHEASIIQQRQESKNVSLDNLFEQMKQGEMKDLNVIIKGDVQGSVEALAASLMKIDVEGVNVRIIHTAVGAINESDVTLANASNGIIIGFNVRPDSGAKRAAEAENVDMRLHRVIYNVIEEIESAMKGLLDPEFEEQVIGQAEVRQTFKVSKVGTIAGCYVTEGKITRNAGVRIIRDGIVQYEGELDTLKRFKDDAKEVAKGYECGITIENYNDLKEGDVIEAFEMVEIKR

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS06645 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]