From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0780 [new locus tag: SACOL_RS04015 ]
  • pan locus tag?: SAUPAN002608000
  • symbol: recQ1
  • pan gene symbol?: recQ1
  • synonym:
  • product: ATP-dependent DNA helicase RecQ

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL0780 [new locus tag: SACOL_RS04015 ]
  • symbol: recQ1
  • product: ATP-dependent DNA helicase RecQ
  • replicon: chromosome
  • strand: +
  • coordinates: 802796..804577
  • length: 1782
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    ATGATGCAACAAACATTATCGCATTACTTTGGGTATGAAACGTTTCGACCAGGACAAGAA
    GAAATTATTAGCAAAGTATTAGACCATCGTAATGTGCTTGGTGTCTTACCAACTGGTGGA
    GGTAAGTCTATATGCTATCAAGTACCAGGTTTATTGTTAGGTGGTACAACAATTGTAATA
    AGTCCACTAATATCATTAATGAAAGATCAAGTGGATCAATTAAAAGCGATGGGAATTCAA
    GCTGCTTTTTTAAATAGTAGTTTGACTCAAAAAGAGCAACAACGTATTGAAAAAGCATTA
    TCAAATGGAGAAATTCAATTTTTGTATGTTGCACCAGAACGATTTGAAAACCGATATTTT
    TTAAATATGCTTCAGCGTATAAAGATTCACTTAGTCGCGTTTGATGAAGCGCATTGTATT
    TCTAAATGGGGTCATGATTTCAGGCCGAGTTACCAAAATGTTATTTCAAAAGTATTTACG
    TTACCTCAAGATTTTACAATAATAGCGTTGACAGCAACTGCCACGGTTGAAGTACAGCAA
    GATATTAGAGAAAAGTTAAATATCGCTCAAACTGATCAAATTAAAACGAGTACTAAGCGT
    AGAAACTTAATTTTTAAAGTAAATCCTACTTATCAACGTCAAAAATTTATATTGGATTAT
    ATTAAAACACACGATGAAGATGCAGGTATTATTTATTGTTCTACACGTAAGCAAGTTGAA
    GAGCTTCAAGAAGCCTTAGAAAGTCAGAAAATTGAAAGTGTTATATATCATGCAGGTTTG
    AGCAATAAAGAAAGAGAAGAAGCGCAGAATGATTTCTTATTTGATCGTGTTAAAGTAGTC
    GTTGCTACAAATGCTTTTGGTATGGGTATTGATAAATCCAATGTACGCTTTGTTATTCAT
    TATAATATGCCTGGAGATTTAGAATCTTATTATCAAGAAGCGGGTCGTGCAGGTCGTGAC
    GGGTTGAAAAGTGAATGTATTTTGTTATTTAGCGAACGCGATATCAATTTACACGAGTAT
    TTTATAACAGTCTCTCAAGCTGATGATGACTATAAAGATAAAATGGGCGAAAAGTTAACT
    AAAATGATTCAATATACAAAAACAAAAAAATGTCTAGAAGCAACAATTGTCCATTATTTT
    GAACCGAATGAAAAATTAGAAGAATGTGAACAATGTAGTAATTGTGTTCAACAAGATAAA
    TCATATAATATGACACAAGAAGCTAAGATGATTATTAGTTGCATCGCTCGTATGAAACAA
    CAAGAGAGTTATAGTGTTATCATTCAAGTGTTAAGAGGAGAGTCAACAGATTATATTAAG
    TATAAAGGTTATGACCAAATTTCAACCCATGGTTTAATGAAAGGTTACACAACATCAGAA
    TTAAGTCACTTAATAGATGAATTAAGATTCAAAGGGTTCTTAAATGAAAATGACGAAATA
    TTAATGTGTGATACTTCAATTAAAAAATTACTCAGTAATGAAGTAGAAGTATTCACAACA
    CCATTTAAGCAAAAAGCGACTGAAAAAGTATTTATAAATACGGTTGAAGGGGTTGACCGA
    GTATTATTCAGTCAGTTGGTAGAAGTTCGTAAAAAGTTAAGTGACAAATTAACGATAGCA
    CCTGTAAGTATATTTTCTGATTACACGTTGGAGGAATTTGCTAAACGTAAGCCTGCTTCG
    AAACAAGATATGATTAATATTGATGGCGTAGGTAGTTACAAATTAAAACATTATTGTCCA
    GCATTTTTAGAAACGATTCAAAATTATAAAGCCAAAGTATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1782

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL0780 [new locus tag: SACOL_RS04015 ]
  • symbol: RecQ1
  • description: ATP-dependent DNA helicase RecQ
  • length: 593
  • theoretical pI: 6.83017
  • theoretical MW: 68169.7
  • GRAVY: -0.376223

Function[edit source | edit]

  • reaction:
    EC 3.6.1.-?  ExPASy
  • TIGRFAM:
    Genetic information processingDNA metabolismDNA replication, recombination, and repairATP-dependent DNA helicase RecQ (TIGR01389; EC 3.6.4.12; HMM-score: 902.3)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairATP-dependent DNA helicase, RecQ family (TIGR00614; EC 3.6.4.12; HMM-score: 455.6)
    DEXH box helicase, DNA ligase-associated (TIGR04121; EC 3.6.4.-; HMM-score: 52.9)
    helicase/secretion neighborhood putative DEAH-box helicase (TIGR03817; HMM-score: 46)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairATP-dependent DNA helicase RecG (TIGR00643; EC 3.6.4.12; HMM-score: 35.1)
  • TheSEED:  
    DNA MetabolismDNA repairDNA repair, bacterial RecFOR pathway ATP-dependent DNA helicase RecQ 
    DNA replicationDNA-replication ATP-dependent DNA helicase RecQ 
  • PFAM:
    P-loop_NTPase (CL0023) Helicase_C; Helicase conserved C-terminal domain (PF00271; HMM-score: 93.7)
    HTH (CL0123) RQC; RQC domain (PF09382; HMM-score: 77)
    P-loop_NTPase (CL0023) DEAD; DEAD/DEAH box helicase (PF00270; HMM-score: 75.2)
    HRDC-like (CL0426) HRDC; HRDC domain (PF00570; HMM-score: 61.5)
    no clan definedRecQ_Zn_bind; RecQ zinc-binding (PF16124; HMM-score: 42.7)
    DUF1033; Protein of unknown function (DUF1033) (PF06279; HMM-score: 14.5)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SACOL2657(arcA)arginine deiminase  [1] (data from MRSA252)
    SACOL2656(arcB2)ornithine carbamoyltransferase  [1] (data from MRSA252)
    SACOL0593(fusA)elongation factor G  [1] (data from MRSA252)
    SACOL0460(guaB)inosine-5'-monophosphate dehydrogenase  [1] (data from MRSA252)
    SACOL1513(hup)DNA-binding protein HU  [1] (data from MRSA252)
    SACOL1102(pdhA)pyruvate dehydrogenase complex E1 component subunit alpha  [1] (data from MRSA252)
    SACOL0586(rplL)50S ribosomal protein L7/L12  [1] (data from MRSA252)
    SACOL1257(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    SACOL2237(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    SACOL2213(rpoA)DNA-directed RNA polymerase subunit alpha  [1] (data from MRSA252)
    SACOL0588(rpoB)DNA-directed RNA polymerase subunit beta  [1] (data from MRSA252)
    SACOL0589(rpoC)DNA-directed RNA polymerase subunit beta'  [1] (data from MRSA252)
    SACOL1769(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    SACOL2222(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SACOL0438(ssb2)single-stranded DNA-binding protein  [1] (data from MRSA252)
    SACOL0731LysR family transcriptional regulator  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.115
    • Ymax_pos: 70
    • Cmax: 0.108
    • Cmax_pos: 46
    • Smax: 0.19
    • Smax_pos: 67
    • Smean: 0.095
    • D: 0.107
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MMQQTLSHYFGYETFRPGQEEIISKVLDHRNVLGVLPTGGGKSICYQVPGLLLGGTTIVISPLISLMKDQVDQLKAMGIQAAFLNSSLTQKEQQRIEKALSNGEIQFLYVAPERFENRYFLNMLQRIKIHLVAFDEAHCISKWGHDFRPSYQNVISKVFTLPQDFTIIALTATATVEVQQDIREKLNIAQTDQIKTSTKRRNLIFKVNPTYQRQKFILDYIKTHDEDAGIIYCSTRKQVEELQEALESQKIESVIYHAGLSNKEREEAQNDFLFDRVKVVVATNAFGMGIDKSNVRFVIHYNMPGDLESYYQEAGRAGRDGLKSECILLFSERDINLHEYFITVSQADDDYKDKMGEKLTKMIQYTKTKKCLEATIVHYFEPNEKLEECEQCSNCVQQDKSYNMTQEAKMIISCIARMKQQESYSVIIQVLRGESTDYIKYKGYDQISTHGLMKGYTTSELSHLIDELRFKGFLNENDEILMCDTSIKKLLSNEVEVFTTPFKQKATEKVFINTVEGVDRVLFSQLVEVRKKLSDKLTIAPVSIFSDYTLEEFAKRKPASKQDMINIDGVGSYKLKHYCPAFLETIQNYKAKV

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [2]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15

Relevant publications[edit source | edit]