From AureoWiki
Jump to: navigation, search
NCBI: 10-JUN-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0960 [new locus tag: SACOL_RS04920 ]
  • pan locus tag?: SAUPAN003059000
  • symbol: rocD
  • pan gene symbol?: rocD
  • synonym:
  • product: ornithine--oxo-acid transaminase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL0960 [new locus tag: SACOL_RS04920 ]
  • symbol: rocD
  • product: ornithine--oxo-acid transaminase
  • replicon: chromosome
  • strand: +
  • coordinates: 961329..962519
  • length: 1191
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    ATGACTAAATCTGAAAAAATTATTGAGTTAACAAATCATTACGGAGCACATAATTATTTA
    CCATTGCCAATTGTCATTTCAGAAGCTGAAGGGGTATGGGTTAAAGATCCTGAAGGCAAT
    AAATATATGGATATGTTATCTGCATATTCCGCTGTTAACCAAGGTCATAGACATCCGAAA
    ATTATTCAAGCATTAAAAGATCAAGCTGATAAAGTGACTTTAGTTTCACGTGCTTTTCAT
    AGTGATAACTTAGGTGAATGGTACGAAAAAATTTGTAAACTGGCAGGTAAAGATAAAGCT
    TTACCAATGAATACAGGTGCTGAAGCAGTAGAAACAGCTTTGAAAGCAGCACGACGCTGG
    GCATACGATGTTAAAGGAATTGAGCCAAATAAAGCAGAAATCATTGCATTTAATGGTAAC
    TTCCATGGTCGAACAATGGCGCCAGTTTCATTATCTTCAGAAGCAGAATACCAACGTGGT
    TATGGTCCGTTATTAGATGGATTTAGAAAAGTTGATTTTGGAGATGTAGATGCATTGAAA
    GCTGCAATTAATGAAAATACTGCAGCAGTTTTAGTAGAACCAATTCAAGGTGAAGCGGGT
    ATAAATATACCGCCAGAAGGATATTTGAAAGCAATTAGAGAATTATGTGATGAACATAAT
    GTCTTATTTATTGCTGACGAAATCCAAGCAGGATTAGGTCGTTCGGGTAAATTATTTGCT
    ACGGATTGGGATAATGTAAAACCTGATGTCTATATTTTAGGTAAAGCACTAGGTGGTGGA
    GTCTTCCCAATTTCTGTTGTATTAGCAGATAAAGAAGTATTAGATGTCTTTACACCTGGC
    TCACATGGTTCAACATTTGGTGGTAATCCACTTGCTTGTGCTGCATCAATTGCTGCATTA
    GATGTTATCGTTGATGAGGATTTACCAGGCCGCTCTTTAGAATTAGGAGATTATTTTAAA
    GAACAATTAAAGCAAATTGATCATCCATCAATTAAAGAAGTCCGTGGACGTGGTTTGTTT
    ATAGGTGTGGAACTTAATGAAAGTGCTAGACCATATTGTGAAGCTTTGAAAGAAGAAGGC
    TTATTATGTAAAGAAACGCATGATACTGTCATTCGTTTTGCACCACCATTAATTATTACT
    AAAGAAGAATTGGACCTTGCACTTGAAAAAATAAGACATGTATTTCAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1191

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL0960 [new locus tag: SACOL_RS04920 ]
  • symbol: RocD
  • description: ornithine--oxo-acid transaminase
  • length: 396
  • theoretical pI: 5.02774
  • theoretical MW: 43417.2
  • GRAVY: -0.183333

Function[edit source | edit]

  • reaction:
    EC 2.6.1.13?  ExPASy
    Ornithine aminotransferaseL-ornithine + a 2-oxo acid = L-glutamate 5-semialdehyde + an L-amino acid
  • TIGRFAM:
    ornithine--oxo-acid transaminase (TIGR01885; EC 2.6.1.13; HMM-score: 538.4)
    transaminase, acetylornithine/succinylornithine family (TIGR00707; HMM-score: 402)
    MetabolismEnergy metabolismAmino acids and aminessuccinylornithine transaminase family (TIGR03246; EC 2.6.1.81; HMM-score: 310.5)
    MetabolismCentral intermediary metabolismPolyamine biosynthesisputrescine aminotransferase (TIGR03372; EC 2.6.1.82; HMM-score: 256.2)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersBiotinadenosylmethionine-8-amino-7-oxononanoate transaminase (TIGR00508; EC 2.6.1.62; HMM-score: 249.2)
    MetabolismCentral intermediary metabolismOther4-aminobutyrate transaminase (TIGR00700; EC 2.6.1.19; HMM-score: 248.1)
    MetabolismCentral intermediary metabolismOther2,4-diaminobutyrate 4-transaminase (TIGR00709; EC 2.6.1.-; HMM-score: 209.8)
    Cellular processesCellular processesAdaptations to atypical conditionsdiaminobutyrate--2-oxoglutarate aminotransferase (TIGR02407; EC 2.6.1.76; HMM-score: 188.8)
    L-lysine 6-transaminase (TIGR03251; EC 2.6.1.36; HMM-score: 155.7)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminglutamate-1-semialdehyde-2,1-aminomutase (TIGR00713; EC 5.4.3.8; HMM-score: 143.3)
    MetabolismCentral intermediary metabolismOther4-aminobutyrate aminotransferase (TIGR00699; EC 2.6.1.19; HMM-score: 107)
    Genetic information processingProtein synthesistRNA and rRNA base modificationcysteine desulfurase IscS (TIGR02006; EC 2.8.1.7; HMM-score: 16.4)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOthercysteine desulfurase IscS (TIGR02006; EC 2.8.1.7; HMM-score: 16.4)
    cysteine desulfurase, NifS family (TIGR03403; EC 2.8.1.7; HMM-score: 15.6)
    MetabolismEnergy metabolismAmino acids and aminestyrosine aminotransferase (TIGR01264; EC 2.6.1.5; HMM-score: 15.1)
    tyrosine/nicotianamine family aminotransferase (TIGR01265; HMM-score: 15)
    cysteine desulfurase NifS (TIGR03402; EC 2.8.1.7; HMM-score: 11.8)
  • TheSEED:  
    Amino Acids and DerivativesArginine; urea cycle, polyaminesArginine and Ornithine Degradation Ornithine aminotransferase (EC 2.6.1.13) 
  • PFAM:
    PLP_aminotran (CL0061) Aminotran_3; Aminotransferase class-III (PF00202; HMM-score: 446.1)
    Aminotran_1_2; Aminotransferase class I and II (PF00155; HMM-score: 24.2)
    DegT_DnrJ_EryC1; DegT/DnrJ/EryC1/StrS aminotransferase family (PF01041; HMM-score: 23)
    Beta_elim_lyase; Beta-eliminating lyase (PF01212; HMM-score: 14.9)
    Aminotran_5; Aminotransferase class-V (PF00266; HMM-score: 12.1)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: pyridoxal 5'-phosphate
  • effectors:
  • protein partners:
    SACOL2657(arcA)arginine deiminase  [1] (data from MRSA252)
    SACOL1637(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    SACOL2415(gpmA)phosphoglyceromutase  [1] (data from MRSA252)
    SACOL1741(icd)isocitrate dehydrogenase  [1] (data from MRSA252)
    SACOL2623(mqo2)malate:quinone oxidoreductase  [1] (data from MRSA252)
    SACOL1103(pdhB)pyruvate dehydrogenase complex E1 component subunit beta  [1] (data from MRSA252)
    SACOL1104(pdhC)branched-chain alpha-keto acid dehydrogenase E2  [1] (data from MRSA252)
    SACOL1105(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    SACOL0839(pgk)phosphoglycerate kinase  [1] (data from MRSA252)
    SACOL1745(pyk)pyruvate kinase  [1] (data from MRSA252)
    SACOL0584(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    SACOL2236(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    SACOL2227(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    SACOL2220(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    SACOL1257(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    SACOL1725(rplT)50S ribosomal protein L20  [1] (data from MRSA252)
    SACOL1702(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    SACOL1700(rpmA)50S ribosomal protein L27  [1] (data from MRSA252)
    SACOL1274(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    SACOL1769(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    SACOL2222(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SACOL2206(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    SACOL2214(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    SACOL0594(tuf)elongation factor Tu  [1] (data from MRSA252)
    SACOL0564pyridoxal biosynthesis lyase PdxS  [1] (data from MRSA252)
    SACOL0944NADH dehydrogenase  [1] (data from MRSA252)
    SACOL0973fumarylacetoacetate hydrolase  [1] (data from MRSA252)
    SACOL1759universal stress protein  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.134
    • Ymax_pos: 30
    • Cmax: 0.186
    • Cmax_pos: 30
    • Smax: 0.168
    • Smax_pos: 26
    • Smean: 0.091
    • D: 0.117
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MTKSEKIIELTNHYGAHNYLPLPIVISEAEGVWVKDPEGNKYMDMLSAYSAVNQGHRHPKIIQALKDQADKVTLVSRAFHSDNLGEWYEKICKLAGKDKALPMNTGAEAVETALKAARRWAYDVKGIEPNKAEIIAFNGNFHGRTMAPVSLSSEAEYQRGYGPLLDGFRKVDFGDVDALKAAINENTAAVLVEPIQGEAGINIPPEGYLKAIRELCDEHNVLFIADEIQAGLGRSGKLFATDWDNVKPDVYILGKALGGGVFPISVVLADKEVLDVFTPGSHGSTFGGNPLACAASIAALDVIVDEDLPGRSLELGDYFKEQLKQIDHPSIKEVRGRGLFIGVELNESARPYCEALKEEGLLCKETHDTVIRFAPPLIITKEELDLALEKIRHVFQ

Experimental data[edit source | edit]

  • experimentally validated: PeptideAtlas
    experimental localization: Cytoplasmic [2] [3] [4] [5]
    quantitative data / protein copy number per cell: 683 [6]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: ArgR
    ArgR (TF) important in Arginine biosynthesis, Arginine degradation  RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27

Relevant publications[edit source | edit]