From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS07070 [old locus tag: SACOL1389 ]
  • pan locus tag?: SAUPAN003741000
  • symbol: SACOL_RS07070
  • pan gene symbol?: parE
  • synonym:
  • product: DNA topoisomerase IV subunit B

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SACOL_RS07070 [old locus tag: SACOL1389 ]
  • symbol: SACOL_RS07070
  • product: DNA topoisomerase IV subunit B
  • replicon: chromosome
  • strand: +
  • coordinates: 1395979..1397970
  • length: 1992
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002951 (1395979..1397970) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    ATGAATAAACAAAATAATTATTCAGATGATTCAATACAGGTTTTAGAGGGGTTAGAAGCA
    GTTCGTAAAAGACCTGGTATGTATATTGGATCAACTGATAAACGGGGATTGCATCATCTA
    GTATATGAAATTGTCGATAACTCCGTCGATGAAGTATTGAATGGTTACGGTAACGAAATA
    GATGTAACAATTAATAAAGATGGTAGTATTTCTATAGAAGATAATGGACGTGGTATGCCA
    ACAGGTATACATAAATCAGGTAAACCGACAGTCGAAGTTATCTTTACTGTTTTACATGCA
    GGAGGTAAATTTGGACAAGGCGGCTATAAAACTTCAGGTGGTCTTCACGGTGTTGGTGCT
    TCAGTTGTAAATGCATTGAGTGAATGGCTTGAAGTTGAAATCCATCGAGATGGTAATATA
    TATCATCAAAGTTTTAAAAACGGTGGTTCGCCATCTTCTGGTTTAGTGAAAAAAGGTAAA
    ACTAAGAAAACAGGTACCAAAGTAACATTTAAACCTGATGACACAATTTTTAAAGCATCT
    ACATCATTTAATTTTGATGTTTTAAGTGAACGACTACAAGAGTCTGCGTTCTTATTGAAA
    AATTTAAAAATAACGCTTAATGATTTACGCAGTGGTAAAGAGCGTCAAGAGCATTACCAT
    TATGAAGAAGGAATCAAAGAGTTTGTTAGTTATGTCAATGAAGGAAAAGAAGTTTTGCAT
    GACGTGGCTACATTTTCAGGTGAAGCAAATGGTATAGAGGTAGACGTAGCTTTCCAATAT
    AATGATCAATATTCAGAAAGTATTTTAAGTTTTGTAAATAATGTACGTACTAAAGATGGT
    GGTACACATGAAGTTGGTTTTAAAACAGCAATGACACGTGTATTTAATGATTATGCACGT
    CGTATTAATGAACTTAAAACAAAAGATAAAAACTTAGATGGTAATGATATTCGTGAAGGT
    TTAACAGCTGTTGTGTCTGTTCGTATTCCAGAAGAATTATTGCAATTTGAAGGACAAACG
    AAATCTAAATTGGGTACTTCTGAAGCTAGAAGTGCTGTTGATTCAGTTGTTGCAGACAAA
    TTGCCATTCTATTTAGAAGAAAAAGGACAATTGTCTAAATCACTTGTGAAAAAAGCGATT
    AAAGCACAACAAGCAAGGGAAGCTGCACGTAAAGCTCGTGAAGATGCTCGTTCAGGTAAG
    AAAAACAAGCGTAAAGACACTTTGCTATCTGGTAAATTAACACCTGCACAAAGTAAAAAC
    ACTGAAAAAAATGAATTGTATTTAGTCGAAGGTGATTCTGCGGGAGGTTCAGCAAAACTT
    GGACGAGACCGCAAATTCCAAGCGATATTACCATTACGTGGTAAGGTAATTAATACAGAG
    AAAGCACGTCTAGAAGATATTTTTAAAAATGAAGAAATTAATACAATTATCCACACAATC
    GGGGCAGGCGTTGGTACTGACTTTAAAATTGAAGATAGTAATTATAATCGTGTAATTATT
    ATGACTGATGCTGATACTGATGGTGCGCATATTCAAGTGCTATTGTTAACATTCTTCTTC
    AAATATATGAAACCGCTTGTTCAAGCAGGTCGTGTATTTATTGCTTTACCTCCACTTTAT
    AAATTGGAAAAAGGTAAAGGCAAAACAAAGCGAGTTGAATACGCTTGGACAGACGAAGAG
    CTTAATAAATTGCAAAAAGAACTTGGTAAAGGCTTCACGTTACAACGTTACAAAGGTTTG
    GGTGAAATGAACCCTGAACAATTATGGGAAACGACGATGAACCCAGAAACACGAACTTTA
    ATTCGTGTACAAGTTGAAGATGAAGTGCGTTCATCTAAACGTGTAACAACATTAATGGGT
    GACAAAGTACAACCTAGACGTGAATGGATTGAAAAGCATGTTGAGTTTGGTATGCAAGAG
    GACCAAAGTATTTTAGATAATTCTGAAGTACAAGTGCTTGAAAATGATCAATTTGATGAG
    GAGGAAATCTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    1992

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SACOL_RS07070 [old locus tag: SACOL1389 ]
  • symbol: SACOL_RS07070
  • description: DNA topoisomerase IV subunit B
  • length: 663
  • theoretical pI: 6.9121
  • theoretical MW: 74363.3
  • GRAVY: -0.632278

Function[edit source | edit]

  • reaction:
    EC 5.99.1.3?  ExPASy
    DNA topoisomerase (ATP-hydrolyzing)ATP-dependent breakage, passage and rejoining of double-stranded DNA
  • TIGRFAM:
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA topoisomerase IV, B subunit (TIGR01058; EC 5.99.1.-; HMM-score: 1068.2)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA gyrase, B subunit (TIGR01059; EC 5.99.1.3; HMM-score: 864.7)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA topoisomerase IV, B subunit (TIGR01055; EC 5.99.1.-; HMM-score: 541.5)
  • TheSEED:
  • PFAM:
    S5 (CL0329) DNA_gyraseB; DNA gyrase B (PF00204; HMM-score: 197.2)
    no clan definedDNA_gyraseB_C; DNA gyrase B subunit, carboxyl terminus (PF00986; HMM-score: 102.2)
    His_Kinase_A (CL0025) HATPase_c; Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase (PF02518; HMM-score: 83.4)
    Toprim-like (CL0413) Toprim; Toprim domain (PF01751; HMM-score: 64.1)
    His_Kinase_A (CL0025) HATPase_c_3; Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase (PF13589; HMM-score: 23.6)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: Ca2+, Mg2+, Mn2+
  • effectors:
  • protein partners:
    SACOL_RS0304050S ribosomal protein L7/L12  [1] (data from MRSA252)
    SACOL_RS03050DNA-directed RNA polymerase subunit beta  [1] (data from MRSA252)
    SACOL_RS03080elongation factor Tu  [1] (data from MRSA252)
    SACOL_RS03755LysR family transcriptional regulator  [1] (data from MRSA252)
    SACOL_RS05630pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SACOL_RS05635pyruvate dehydrogenase E1 component subunit beta  [1] (data from MRSA252)
    SACOL_RS05640dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex  [1] (data from MRSA252)
    SACOL_RS05645dihydrolipoyl dehydrogenase  [1] (data from MRSA252)
    SACOL_RS07705DNA-binding protein HU  [1] (data from MRSA252)
    SACOL_RS0868050S ribosomal protein L21  [1] (data from MRSA252)
    SACOL_RS1165530S ribosomal protein S11  [1] (data from MRSA252)
    SACOL_RS1168550S ribosomal protein L15  [1] (data from MRSA252)
    SACOL_RS1169530S ribosomal protein S5  [1] (data from MRSA252)
    SACOL_RS1175550S ribosomal protein L22  [1] (data from MRSA252)
    SACOL_RS1176550S ribosomal protein L2  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.67
    • Cytoplasmic Membrane Score: 0.01
    • Cellwall Score: 0.15
    • Extracellular Score: 0.17
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.101
    • Ymax_pos: 58
    • Cmax: 0.106
    • Cmax_pos: 9
    • Smax: 0.135
    • Smax_pos: 51
    • Smean: 0.097
    • D: 0.1
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 486199655 NCBI
  • RefSeq: WP_001548666 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MNKQNNYSDDSIQVLEGLEAVRKRPGMYIGSTDKRGLHHLVYEIVDNSVDEVLNGYGNEIDVTINKDGSISIEDNGRGMPTGIHKSGKPTVEVIFTVLHAGGKFGQGGYKTSGGLHGVGASVVNALSEWLEVEIHRDGNIYHQSFKNGGSPSSGLVKKGKTKKTGTKVTFKPDDTIFKASTSFNFDVLSERLQESAFLLKNLKITLNDLRSGKERQEHYHYEEGIKEFVSYVNEGKEVLHDVATFSGEANGIEVDVAFQYNDQYSESILSFVNNVRTKDGGTHEVGFKTAMTRVFNDYARRINELKTKDKNLDGNDIREGLTAVVSVRIPEELLQFEGQTKSKLGTSEARSAVDSVVADKLPFYLEEKGQLSKSLVKKAIKAQQAREAARKAREDARSGKKNKRKDTLLSGKLTPAQSKNTEKNELYLVEGDSAGGSAKLGRDRKFQAILPLRGKVINTEKARLEDIFKNEEINTIIHTIGAGVGTDFKIEDSNYNRVIIMTDADTDGAHIQVLLLTFFFKYMKPLVQAGRVFIALPPLYKLEKGKGKTKRVEYAWTDEELNKLQKELGKGFTLQRYKGLGEMNPEQLWETTMNPETRTLIRVQVEDEVRSSKRVTTLMGDKVQPRREWIEKHVEFGMQEDQSILDNSEVQVLENDQFDEEEI

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SACOL_RS07070 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14

Relevant publications[edit source | edit]