From AureoWiki
Jump to: navigation, search
NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_01170
  • pan locus tag?: SAUPAN003483000
  • symbol: carB
  • pan gene symbol?: carB
  • synonym:
  • product: carbamoyl phosphate synthase large subunit

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_01170
  • symbol: carB
  • product: carbamoyl phosphate synthase large subunit
  • replicon: chromosome
  • strand: +
  • coordinates: 1118950..1122123
  • length: 3174
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    2161
    2221
    2281
    2341
    2401
    2461
    2521
    2581
    2641
    2701
    2761
    2821
    2881
    2941
    3001
    3061
    3121
    ATGCCTAAACGTAATGATATCAAAACAATTTTAGTAATAGGGTCTGGGCCAATTATCATA
    GGTCAAGCAGCTGAATTTGATTATGCTGGAACACAAGCATGTCTAGCTTTAAAAGAAGAG
    GGATATCGAGTTATTCTTGTAAATTCAAATCCAGCGACAATCATGACTGATAAGGAAATT
    GCGGATAAAGTATATATCGAACCGTTAACTCATGATTTTATAGCGCGAATTATACGTAAA
    GAGCAACCTGACGCTTTACTTCCAACTTTAGGTGGTCAAACAGGTTTAAACATGGCGATT
    CAACTACACGAAAGTGGTGTGCTTCAAGATAATAACGTCCAATTATTAGGAACTGAGCTA
    ACATCAATTCAACAAGCAGAAGACCGTGAAATGTTTAGAACATTAATGAATGATTTAAAC
    GTTCCTGTACCAGAGAGTGACATTGTAAATACAGTAGAGCAAGCCTTTAAATTCAAAGAG
    CAAGTGGGATACCCGCTAATTGTTAGACCGGCATTTACGATGGGTGGTACCGGAGGCGGT
    ATTTGTCATAATGATGAAGAATTACATGAAATCGTCTCAAATGGTCTTCATTATAGTCCA
    GCAACGCAATGTTTATTAGAAAAATCTATCGCAGGTTTTAAAGAAATCGAATACGAAGTA
    ATGCGTGATAAAAACGATAATGCCATCGTTGTATGTAACATGGAAAATATTGATCCAGTT
    GGTATTCATACAGGCGATTCAATTGTTGTGGCTCCTAGTCAAACATTATCAGATGTTGAG
    TATCAAATGTTACGTGATGTTTCATTAAAAGTTATTCGAGCTTTAGGTATCGAAGGTGGT
    TGTAATGTTCAATTAGCATTAGATCCCCATTCATTCGATTATTATATTATAGAAGTAAAT
    CCGCGTGTATCACGTTCATCAGCGTTAGCTTCAAAAGCAACAGGATATCCTATTGCAAAA
    TTAGCTGCTAAAATCGCGGTTGGTCTAACATTAGATGAAATGTTAAATCCAATTACAGGA
    ACATCTTATGCAGCGTTTGAACCAACTTTAGACTATGTGATTTCAAAAATACCAAGATTT
    CCTTTTGATAAATTTGAAAAAGGAGAACGAGAGCTTGGCACACAAATGAAAGCAACAGGT
    GAAGTTATGGCCATTGGTCGAACTTACGAAGAATCATTGTTAAAAGCAATTCGATCACTT
    GAGTATGGTGTGCATCACTTAGGATTACCAAATGGTGAAAGCTTCGATCTTGATTATATT
    AAAGAACGTATTTCACACCAAGATGATGAACGATTATTTTTCATCGGCGAAGCAATTAGA
    AGAGGCACAACATTAGAAGAAATTCATAATATGACTCAGATTGATTACTTCTTCTTACAC
    AAGTTCCAAAACATTATTGATATTGAGCATCAATTAAAAGAGCATCAAGGTGATTTAGAA
    TATCTTAAATATGCAAAAGATTATGGATTTAGTGATAAAACAATAGCGCATCGCTTTAAT
    ATGACGGAAGAAGAAGTATATCAATTGCGTATGGAAAATGATATTAAACCTGTTTACAAG
    ATGGTTGATACTTGCGCAGCTGAATTTGAATCTTCAACACCATATTATTATGGTACATAC
    GAAACTGAAAATGAATCCATAGTTACTGACAAAGAAAAAATCTTAGTATTAGGCTCTGGA
    CCAATTCGAATCGGCCAAGGTGTAGAATTTGACTATGCGACAGTTCACGCCGTTTGGGCA
    ATTCAAAAAGCAGGGTACGAAGCGATAATTGTGAATAACAATCCAGAAACAGTTTCAACA
    GACTTCTCAATTTCTGACAAATTATACTTTGAACCTTTAACTGAAGAAGATGTGATGAAT
    ATCATTAATTTAGAAAAACCTAAAGGTGTCGTTGTACAATTTGGAGGACAAACAGCGATT
    AATTTAGCAGACAAATTGGCTAAACATGGTGTTAAAATACTTGGTACTTCACTAGAAAAT
    CTAAATCGTGCTGAAGATAGAAAAGAATTTGAAGCACTATTAAGAAAAATTAACGTGCCA
    CAGCCACAAGGGAAAACAGCTACATCACCTGAGGAAGCATTAGCGAATGCTGCAGAAATC
    GGATATCCGGTTGTAGTAAGACCTTCTTATGTATTAGGTGGTCGCGCAATGGAAATTGTA
    GACAATGACAAAGAGTTAGAAAACTATATGACCCAGGCTGTAAAAGCGAGTCCGGAACAT
    CCGGTACTAGTCGATAGATATTTAACTGGTAAAGAAATTGAAGTTGATGCGATTTGTGAT
    GGAGAAACGGTCATTATTCCAGGAATCATGGAACATATTGAACGTGCTGGTGTGCATAGT
    GGTGACTCAATCGCTGTATATCCACCACAAACTTTGACAGAAGACGAGTTAGCAACACTT
    GAGGACTATACTATAAAATTAGCTAAAGGTTTAAACATCATTGGCTTAATCAACATTCAA
    TTCGTTATAGCTCACGATGGTGTGTATGTTTTAGAAGTAAATCCACGTTCTAGTAGAACG
    GTACCATTCTTAAGTAAAATTACTGATATTCCAATGGCACAATTAGCTATGCGAGCAATC
    ATTGGGGAAAAACTAACAGATATGGGTTATCAAGAAGGGGTTCAACCATATGCTGAGGGT
    GTCTTTGTGAAAGCACCAGTATTTAGTTTTAATAAATTGAAAAATGTTGATATTACTTTA
    GGACCTGAAATGAAGTCAACAGGTGAAGTGATGGGGAAAGATACTACATTAGAAAAGGCG
    TTATTCAAAGGGTTAACAGGTAGTGGCGTTGAAGTTAAAGATCACGGTACAGTATTAATG
    ACCGTCAGTGACAAAGATAAAGAGGAAGTTGTTAAATTGGCACAACGCTTAAATGAAGTT
    GGCTATAAAATTTTAGCAACGTCTGGAACAGCTAATAAATTAGCTGAGTATGACATACCT
    GCAGAAGTAGTAGGCAAAATTGGTGGCGAAAATGATTTATTAACACGTATTCAAAATGGT
    GATGTTCAAATCGTTATAAATACAATGACTAAAGGTAAAGAAGTAGAAAGGGATGGCTTC
    CAAATTAGACGTACTACAGTTGAAAATGGTATTCCATGTTTGACATCTTTAGATACAGCT
    AATGCCTTAACGAATGTAATTGAAAGTATGACATTTACAATGCGTCAAATGTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2160
    2220
    2280
    2340
    2400
    2460
    2520
    2580
    2640
    2700
    2760
    2820
    2880
    2940
    3000
    3060
    3120
    3174

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAOUHSC_01170
  • symbol: CarB
  • description: carbamoyl phosphate synthase large subunit
  • length: 1057
  • theoretical pI: 4.60041
  • theoretical MW: 117185
  • GRAVY: -0.194229

Function[edit source | edit]

  • reaction:
    EC 6.3.5.5?  ExPASy
    Carbamoyl-phosphate synthase (glutamine-hydrolyzing)2 ATP + L-glutamine + HCO3(-) + H2O = 2 ADP + phosphate + L-glutamate + carbamoyl phosphate
  • TIGRFAM:
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesPyrimidine ribonucleotide biosynthesiscarbamoyl-phosphate synthase, large subunit (TIGR01369; EC 6.3.5.5; HMM-score: 1581.7)
    MetabolismEnergy metabolismGlycolysis/gluconeogenesispyruvate carboxylase (TIGR01235; EC 6.4.1.1; HMM-score: 128)
    MetabolismFatty acid and phospholipid metabolismBiosynthesisacetyl-CoA carboxylase, biotin carboxylase subunit (TIGR00514; EC 6.3.4.14; HMM-score: 99.8)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesPurine ribonucleotide biosynthesisphosphoribosylglycinamide formyltransferase 2 (TIGR01142; EC 2.1.2.-; HMM-score: 96.2)
    Cell structureCell envelopeBiosynthesis and degradation of murein sacculus and peptidoglycanD-alanine--D-alanine ligase (TIGR01205; EC 6.3.2.4; HMM-score: 91.7)
    MetabolismCentral intermediary metabolismNitrogen metabolismurea carboxylase (TIGR02712; EC 6.3.4.6; HMM-score: 81.9)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesPurine ribonucleotide biosynthesisphosphoribosylamine--glycine ligase (TIGR00877; EC 6.3.4.13; HMM-score: 74.7)
    lysine biosynthesis enzyme LysX (TIGR02144; HMM-score: 68.1)
    Cellular processesCellular processesBiosynthesis of natural productscyanophycin synthetase (TIGR02068; EC 6.3.2.29,6.3.2.30; HMM-score: 67.6)
    MetabolismAmino acid biosynthesisOtherpyrrolysine biosynthesis protein PylC (TIGR03909; HMM-score: 66.4)
    alpha-L-glutamate ligase, RimK family (TIGR00768; EC 6.3.2.-; HMM-score: 57.8)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesPurine ribonucleotide biosynthesisphosphoribosylaminoimidazole carboxylase, ATPase subunit (TIGR01161; EC 4.1.1.21; HMM-score: 52.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOthercoenzyme gamma-F420-2:alpha-L-glutamate ligase (TIGR04443; EC 6.3.2.32; HMM-score: 35.6)
    ATP-grasp enzyme, GAK system (TIGR04356; HMM-score: 27.1)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesPurine ribonucleotide biosynthesisphosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase (TIGR00355; EC 2.1.2.3,3.5.4.10; HMM-score: 21.7)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersHeme, porphyrin, and cobalaminputative heme d1 biosynthesis radical SAM protein NirJ2 (TIGR04055; EC 1.3.99.-; HMM-score: 13.8)
  • TheSEED:  
    Nucleosides and NucleotidesPyrimidinesDe Novo Pyrimidine Synthesis Carbamoyl-phosphate synthase large chain (EC 6.3.5.5) 
  • PFAM:
    ATP-grasp (CL0179) CPSase_L_D2; Carbamoyl-phosphate synthase L chain, ATP binding domain (PF02786; HMM-score: 404.7)
    no clan definedCPSase_L_D3; Carbamoyl-phosphate synthetase large chain, oligomerisation domain (PF02787; HMM-score: 139.6)
    ATP-grasp (CL0179) ATPgrasp_Ter; ATP-grasp in the biosynthetic pathway with Ter operon (PF15632; HMM-score: 96.9)
    no clan definedMGS; MGS-like domain (PF02142; HMM-score: 75.1)
    ATP-grasp (CL0179) ATP-grasp_3; ATP-grasp domain (PF02655; HMM-score: 73.5)
    Dala_Dala_lig_C; D-ala D-ala ligase C-terminus (PF07478; HMM-score: 67.1)
    ATP-grasp; ATP-grasp domain (PF02222; HMM-score: 64.5)
    GARS_A; Phosphoribosylglycinamide synthetase, ATP-grasp (A) domain (PF01071; HMM-score: 56.4)
    ATP-grasp_4; ATP-grasp domain (PF13535; HMM-score: 35.3)
    RimK; RimK-like ATP-grasp domain (PF08443; HMM-score: 30.3)
    ATP-grasp_5; ATP-grasp domain (PF13549; HMM-score: 30.2)
    ATP-grasp_2; ATP-grasp domain (PF08442; HMM-score: 23.7)
    no clan definedPrpR_N; Propionate catabolism activator (PF06506; HMM-score: 12.9)
    TORC_N; Transducer of regulated CREB activity, N terminus (PF12884; HMM-score: 12.5)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: Mg2+, Mn2+
  • effectors:
  • protein partners:
    SAOUHSC_01232(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    SAOUHSC_02494(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SAOUHSC_00530elongation factor Tu  [1] (data from MRSA252)
    SAOUHSC_00679hypothetical protein  [1] (data from MRSA252)
    SAOUHSC_01040pyruvate dehydrogenase complex, E1 component subunit alpha  [1] (data from MRSA252)
    SAOUHSC_01819hypothetical protein  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.28
    • Ymax_pos: 24
    • Cmax: 0.299
    • Cmax_pos: 24
    • Smax: 0.476
    • Smax_pos: 20
    • Smean: 0.235
    • D: 0.262
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MPKRNDIKTILVIGSGPIIIGQAAEFDYAGTQACLALKEEGYRVILVNSNPATIMTDKEIADKVYIEPLTHDFIARIIRKEQPDALLPTLGGQTGLNMAIQLHESGVLQDNNVQLLGTELTSIQQAEDREMFRTLMNDLNVPVPESDIVNTVEQAFKFKEQVGYPLIVRPAFTMGGTGGGICHNDEELHEIVSNGLHYSPATQCLLEKSIAGFKEIEYEVMRDKNDNAIVVCNMENIDPVGIHTGDSIVVAPSQTLSDVEYQMLRDVSLKVIRALGIEGGCNVQLALDPHSFDYYIIEVNPRVSRSSALASKATGYPIAKLAAKIAVGLTLDEMLNPITGTSYAAFEPTLDYVISKIPRFPFDKFEKGERELGTQMKATGEVMAIGRTYEESLLKAIRSLEYGVHHLGLPNGESFDLDYIKERISHQDDERLFFIGEAIRRGTTLEEIHNMTQIDYFFLHKFQNIIDIEHQLKEHQGDLEYLKYAKDYGFSDKTIAHRFNMTEEEVYQLRMENDIKPVYKMVDTCAAEFESSTPYYYGTYETENESIVTDKEKILVLGSGPIRIGQGVEFDYATVHAVWAIQKAGYEAIIVNNNPETVSTDFSISDKLYFEPLTEEDVMNIINLEKPKGVVVQFGGQTAINLADKLAKHGVKILGTSLENLNRAEDRKEFEALLRKINVPQPQGKTATSPEEALANAAEIGYPVVVRPSYVLGGRAMEIVDNDKELENYMTQAVKASPEHPVLVDRYLTGKEIEVDAICDGETVIIPGIMEHIERAGVHSGDSIAVYPPQTLTEDELATLEDYTIKLAKGLNIIGLINIQFVIAHDGVYVLEVNPRSSRTVPFLSKITDIPMAQLAMRAIIGEKLTDMGYQEGVQPYAEGVFVKAPVFSFNKLKNVDITLGPEMKSTGEVMGKDTTLEKALFKGLTGSGVEVKDHGTVLMTVSDKDKEEVVKLAQRLNEVGYKILATSGTANKLAEYDIPAEVVGKIGGENDLLTRIQNGDVQIVINTMTKGKEVERDGFQIRRTTVENGIPCLTSLDTANALTNVIESMTFTMRQM

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.0 1.1 1.2 1.3 1.4 1.5 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  2. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-3661
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  3. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet.: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]