From AureoWiki
Jump to: navigation, search

NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_01750
  • pan locus tag?: SAUPAN004247000
  • symbol: ruvB
  • pan gene symbol?: ruvB
  • synonym:
  • product: Holliday junction DNA helicase RuvB

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_01750
  • symbol: ruvB
  • product: Holliday junction DNA helicase RuvB
  • replicon: chromosome
  • strand: -
  • coordinates: 1654804..1655808
  • length: 1005
  • essential: yes [1] DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    ATGAATGAGCGTATGGTTGATCAATCAATGCATAGTGAAGAAACTGATTTCGAATTGTCG
    CTTAGACCTACGAGATTACGACAATATATTGGTCAAAATTCAATAAAAAGTAATTTAGAA
    GTATTTATTAAAGCGGCTAAACTTCGTCATGAACCATTAGATCATGTATTGCTTTTTGGC
    CCCCCTGGATTAGGTAAGACAACATTATCTAATATCATTGCCAATGAAATGGAAGTTAAT
    ATACGTACAGTATCAGGGCCTTCATTAGAAAGACCTGGTGATTTGGCTGCAATTTTATCA
    GGACTTCAACCTGGAGATGTTTTGTTTATTGATGAAATACACAGACTGAGTAGTGTTGTT
    GAAGAAGTGTTATACCCTGCAATGGAAGATTTCTTTTTAGATATTATCATTGGTAAAGGC
    GATGAGGCTAGAAGTATCCGTATCGACTTACCTCCATTCACTTTGGTAGGTGCAACAACG
    CGAGCTGGCAGCTTAACAGGTCCACTAAGGGATCGATTTGGTGTGCACTTAAGATTAGAA
    TATTATAACGAATCAGATTTAAAAGAAATCATTATTAGAACAGCTGAGGTTTTAGGCACA
    GGTATTGATGAAGAAAGTGCCATTGAACTTGCTAAACGTTCTAGAGGGACTCCAAGAGTA
    GCAAATCGACTATTGAAGCGGGTAAGAGACTTCCAGCAAGTGAATGAAGATGAACAAATA
    TACATTGAAACAACGAAGCACGCATTAGGTTTACTTCAAGTTGATCAACACGGACTAGAT
    TACATTGATCATAAAATGATGAACTGTATTATTAAGCAGTATAATGGCGGACCTGTTGGT
    TTAGATACGATTGCCGTAACAATTGGTGAAGAACGTATTACAATTGAGGACGTTTATGAG
    CCATTTCTTATTCAGAAAGGCTTTTTAGAACGTACGCCACGTGGCAGAAAAGCAACACCA
    TTAGCTTATGAACATTTTGCAAAGTCGAATGAGGAGAGAGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1005

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAOUHSC_01750
  • symbol: RuvB
  • description: Holliday junction DNA helicase RuvB
  • length: 334
  • theoretical pI: 5.0869
  • theoretical MW: 37717.7
  • GRAVY: -0.323054

Function[edit source | edit]

  • reaction:
    EC 3.1.22.4?  ExPASy
    Crossover junction endodeoxyribonucleaseEndonucleolytic cleavage at a junction such as a reciprocal single-stranded crossover between two homologous DNA duplexes (Holliday junction)
    EC 3.6.4.12?  ExPASy
    DNA helicaseATP + H2O = ADP + phosphate
  • TIGRFAM:
    Genetic information processingDNA metabolismDNA replication, recombination, and repairHolliday junction DNA helicase RuvB (TIGR00635; EC 3.6.4.12; HMM-score: 467)
    and 26 more
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA polymerase III, subunit gamma and tau (TIGR02397; EC 2.7.7.7; HMM-score: 32.4)
    Cellular processesCellular processesSporulation and germinationATP-dependent protease, Lon family (TIGR02903; EC 3.4.21.-; HMM-score: 31.2)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent protease, Lon family (TIGR02903; EC 3.4.21.-; HMM-score: 31.2)
    Cellular processesCellular processesSporulation and germinationATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 29.3)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent protease LonB (TIGR02902; EC 3.4.21.-; HMM-score: 29.3)
    AAA family ATPase, CDC48 subfamily (TIGR01243; HMM-score: 26.7)
    26S proteasome subunit P45 family (TIGR01242; HMM-score: 20.6)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairorc1/cdc6 family replication initiation protein (TIGR02928; HMM-score: 19)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingtype VII secretion AAA-ATPase EccA (TIGR03922; HMM-score: 18.7)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDnaA regulatory inactivator Hda (TIGR03420; HMM-score: 18.4)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairchromosomal replication initiator protein DnaA (TIGR00362; HMM-score: 17.8)
    Cellular processesCellular processesCell divisionATP-dependent metallopeptidase HflB (TIGR01241; EC 3.4.24.-; HMM-score: 17.2)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent metallopeptidase HflB (TIGR01241; EC 3.4.24.-; HMM-score: 17.2)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesputative ATP-dependent protease (TIGR00764; HMM-score: 16.2)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesNucleotide and nucleoside interconversionsadenylate kinase (TIGR01351; EC 2.7.4.-; HMM-score: 15.4)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent Clp protease ATP-binding subunit ClpA (TIGR02639; HMM-score: 14.7)
    Unknown functionGeneralMg chelatase-like protein (TIGR00368; HMM-score: 14)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesendopeptidase La (TIGR00763; EC 3.4.21.53; HMM-score: 13.4)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesproteasome ATPase (TIGR03689; EC 3.6.4.8; HMM-score: 13.2)
    Cellular processesCellular processesSporulation and germinationstage V sporulation protein K (TIGR02881; HMM-score: 13.1)
    type IV secretion/conjugal transfer ATPase, VirB4 family (TIGR00929; HMM-score: 12)
    Cellular processesCellular processesOthergas vesicle protein GvpN (TIGR02640; HMM-score: 11.5)
    Genetic information processingDNA metabolismDNA replication, recombination, and repaircheckpoint protein rad24 (TIGR00602; HMM-score: 11.2)
    Genetic information processingProtein fateDegradation of proteins, peptides, and glycopeptidesATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 11.1)
    Genetic information processingProtein fateProtein folding and stabilizationATP-dependent Clp protease, ATP-binding subunit ClpX (TIGR00382; HMM-score: 11.1)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersChlorophyll and bacteriochlorphyllmagnesium chelatase ATPase subunit I (TIGR02030; EC 6.6.1.1; HMM-score: 11.1)
  • TheSEED:  
    DNA MetabolismDNA recombinationRuvABC plus a hypothetical Holliday junction DNA helicase RuvB 
    and 1 more
    DNA replicationDNA-replication Holliday junction DNA helicase RuvB 
  • PFAM:
    P-loop_NTPase (CL0023) RuvB_N; Holliday junction DNA helicase ruvB N-terminus (PF05496; HMM-score: 379.7)
    and 24 more
    HTH (CL0123) RuvB_C; Holliday junction DNA helicase ruvB C-terminus (PF05491; HMM-score: 115)
    P-loop_NTPase (CL0023) AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 67.3)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 31.4)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 22.3)
    AAA_22; AAA domain (PF13401; HMM-score: 19.6)
    DUF815; Protein of unknown function (DUF815) (PF05673; HMM-score: 19.1)
    AAA_3; ATPase family associated with various cellular activities (AAA) (PF07726; HMM-score: 18.7)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 17.4)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 17.2)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 16.9)
    AAA_18; AAA domain (PF13238; HMM-score: 16.6)
    Sigma54_activat; Sigma-54 interaction domain (PF00158; HMM-score: 16.4)
    TIP49; TIP49 C-terminus (PF06068; HMM-score: 16.4)
    AAA_14; AAA domain (PF13173; HMM-score: 16.4)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 16.3)
    NTPase_1; NTPase (PF03266; HMM-score: 14.6)
    AAA_28; AAA domain (PF13521; HMM-score: 14.6)
    ABC_tran; ABC transporter (PF00005; HMM-score: 14.5)
    Sigma54_activ_2; Sigma-54 interaction domain (PF14532; HMM-score: 14.4)
    AAA_19; AAA domain (PF13245; HMM-score: 14.1)
    Bac_DnaA; Bacterial dnaA protein (PF00308; HMM-score: 12.6)
    NB-ARC; NB-ARC domain (PF00931; HMM-score: 12.2)
    T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 11.6)
    Rad17; Rad17 cell cycle checkpoint protein (PF03215; HMM-score: 11.4)

Structure, modifications & interactions[edit source | edit]

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.112
    • Ymax_pos: 46
    • Cmax: 0.118
    • Cmax_pos: 46
    • Smax: 0.147
    • Smax_pos: 44
    • Smean: 0.096
    • D: 0.106
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MNERMVDQSMHSEETDFELSLRPTRLRQYIGQNSIKSNLEVFIKAAKLRHEPLDHVLLFGPPGLGKTTLSNIIANEMEVNIRTVSGPSLERPGDLAAILSGLQPGDVLFIDEIHRLSSVVEEVLYPAMEDFFLDIIIGKGDEARSIRIDLPPFTLVGATTRAGSLTGPLRDRFGVHLRLEYYNESDLKEIIIRTAEVLGTGIDEESAIELAKRSRGTPRVANRLLKRVRDFQQVNEDEQIYIETTKHALGLLQVDQHGLDYIDHKMMNCIIKQYNGGPVGLDTIAVTIGEERITIEDVYEPFLIQKGFLERTPRGRKATPLAYEHFAKSNEERE

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. Roy R Chaudhuri, Andrew G Allen, Paul J Owen, Gil Shalom, Karl Stone, Marcus Harrison, Timothy A Burgis, Michael Lockyer, Jorge Garcia-Lara, Simon J Foster, Stephen J Pleasance, Sarah E Peters, Duncan J Maskell, Ian G Charles
    Comprehensive identification of essential Staphylococcus aureus genes using Transposon-Mediated Differential Hybridisation (TMDH).
    BMC Genomics: 2009, 10;291
    [PubMed:19570206] [WorldCat.org] [DOI] (I e)
  2. 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 2.19 2.20 2.21 2.22 2.23 2.24 2.25 2.26 2.27 2.28 2.29 2.30 2.31 2.32 2.33 2.34 2.35 2.36 2.37 2.38 2.39 2.40 2.41 2.42 2.43 2.44 2.45 2.46 2.47 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  3. Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  4. Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  5. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet.: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit source | edit]