From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS11040 [old locus tag: SA1920 ]
  • pan locus tag?: SAUPAN005409000
  • symbol: SA_RS11040
  • pan gene symbol?: prfA
  • synonym:
  • product: peptide chain release factor 1

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA_RS11040 [old locus tag: SA1920 ]
  • symbol: SA_RS11040
  • product: peptide chain release factor 1
  • replicon: chromosome
  • strand: -
  • coordinates: 2168315..2169391
  • length: 1077
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002745 (2168315..2169391) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    GTGTTTGATCAATTAGATATTGTAGAAGAAAGATACGAACAGTTAAATGAACTGTTAAGT
    GACCCAGATGTTGTAAATGATTCAGATAAATTACGTAAATATTCTAAAGAGCAAGCTGAT
    TTACAAAAAACTGTAGATGTTTATCGTAACTATAAAGCTAAAAAAGAAGAATTAGCTGAT
    ATTGAAGAAATGTTAAGTGAGACTGATGATAAAGAAGAAGTAGAAATGTTAAAAGAGGAG
    AGTAATGGTATTAAAGCTGAACTTCCAAATCTTGAAGAAGAGCTTAAAATATTATTGATT
    CCTAAAGATCCTAATGATGACAAAGACGTTATTGTAGAAATAAGAGCAGCAGCAGGTGGT
    GATGAGGCTGCGATTTTTGCTGGTGATTTAATGCGTATGTATTCAAAGTATGCTGAATCA
    CAAGGATTCAAAACTGAAATAGTAGAAGCGTCTGAAAGTGACCATGGTGGTTACAAAGAA
    ATTAGTTTCTCAGTTTCTGGTAATGGCGCGTATAGTAAATTGAAATTTGAAAATGGTGCG
    CACCGCGTTCAACGTGTGCCTGAAACAGAATCAGGTGGACGTATTCATACTTCAACAGCT
    ACAGTGGCAGTTTTACCAGAAGTTGAAGATGTAGAAATTGAAATTAGAAATGAAGATTTA
    AAAATCGACACGTATCGTTCAAGTGGTGCAGGTGGTCAGCACGTAAACACAACTGACTCT
    GCAGTACGTATTACCCATTTACCAACTGGTGTCATTGCAACATCTTCTGAGAAGTCTCAA
    ATTCAAAACCGTGAAAAAGCAATGAAAGTGTTAAAAGCACGTTTATACGATATGAAAGTT
    CAAGAAGAACAACAAAAGTATGCGTCACAACGTAAATCAGCAGTCGGTACTGGTGATCGT
    TCAGAACGTATTCGAACTTATAATTATCCACAAAGCCGTGTAACAGACCATCGTATAGGT
    CTAACGCTTCAAAAATTAGGGCAAATTATGGAAGGCCATTTAGAAGAAATTATAGATGCA
    CTGACTTTATCAGAGCAGACAGATAAATTGAAAGAACTTAATAATGGTGAATTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1077

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA_RS11040 [old locus tag: SA1920 ]
  • symbol: SA_RS11040
  • description: peptide chain release factor 1
  • length: 358
  • theoretical pI: 4.5415
  • theoretical MW: 40349.6
  • GRAVY: -0.760056

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein synthesisTranslation factorspeptide chain release factor 1 (TIGR00019; HMM-score: 529.5)
    Genetic information processingProtein synthesisTranslation factorspeptide chain release factor 2 (TIGR00020; HMM-score: 300.8)
    Genetic information processingProtein synthesisTranslation factorsputative peptide chain release factor H (TIGR03072; HMM-score: 89.2)
  • TheSEED:
  • PFAM:
    no clan definedPCRF; PCRF domain (PF03462; HMM-score: 248.7)
    RF (CL0337) RF-1; RF-1 domain (PF00472; HMM-score: 135.9)
    no clan definedABC_tran_CTD; ABC transporter C-terminal domain (PF16326; HMM-score: 20.8)
    Trefoil (CL0066) MIR; MIR domain (PF02815; HMM-score: 10.1)
    no clan definedCAF-1_p150; Chromatin assembly factor 1 complex p150 subunit, N-terminal (PF11600; HMM-score: 6.5)
    tRNA_bind_arm (CL0298) Seryl_tRNA_N; Seryl-tRNA synthetase N-terminal domain (PF02403; HMM-score: 6.5)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA_RS09855(gatA)glutamyl-tRNA(Gln) amidotransferase subunit A  [1] (data from MRSA252)
    SA_RS01275formate acetyltransferase  [1] (data from MRSA252)
    SA_RS0201530S ribosomal protein S6  [1] (data from MRSA252)
    SA_RS02095alkyl hydroperoxide reductase subunit C  [1] (data from MRSA252)
    SA_RS02405methionine ABC transporter substrate-binding protein  [1] (data from MRSA252)
    SA_RS0265050S ribosomal protein L25/general stress protein Ctc  [1] (data from MRSA252)
    SA_RS02710cysteine synthase  [1] (data from MRSA252)
    SA_RS02810pyridoxal 5'-phosphate synthase lyase subunit PdxS  [1] (data from MRSA252)
    SA_RS0291050S ribosomal protein L1  [1] (data from MRSA252)
    SA_RS0291550S ribosomal protein L10  [1] (data from MRSA252)
    SA_RS0292050S ribosomal protein L7/L12  [1] (data from MRSA252)
    SA_RS0295030S ribosomal protein S7  [1] (data from MRSA252)
    SA_RS03250zinc-dependent alcohol dehydrogenase  [1] (data from MRSA252)
    SA_RS04140aldehyde dehydrogenase  [1] (data from MRSA252)
    SA_RS04145phosphoglycerate kinase  [1] (data from MRSA252)
    SA_RS04150triose-phosphate isomerase  [1] (data from MRSA252)
    SA_RS04160enolase  [1] (data from MRSA252)
    SA_RS04575NADH dehydrogenase  [1] (data from MRSA252)
    SA_RS05295phosphocarrier protein HPr  [1] (data from MRSA252)
    SA_RS05350pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SA_RS05355pyruvate dehydrogenase E1 component subunit beta  [1] (data from MRSA252)
    SA_RS05620thiol reductase thioredoxin  [1] (data from MRSA252)
    SA_RS05860cell division protein FtsZ  [1] (data from MRSA252)
    SA_RS0612530S ribosomal protein S16  [1] (data from MRSA252)
    SA_RS06170succinyl-CoA ligase subunit alpha  [1] (data from MRSA252)
    SA_RS0622530S ribosomal protein S2  [1] (data from MRSA252)
    SA_RS06235elongation factor Ts  [1] (data from MRSA252)
    SA_RS06490glutamine synthetase  [1] (data from MRSA252)
    SA_RS07060dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex  [1] (data from MRSA252)
    SA_RS07385DNA-binding protein HU  [1] (data from MRSA252)
    SA_RS07605phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)  [1] (data from MRSA252)
    SA_RS0798530S ribosomal protein S20  [1] (data from MRSA252)
    SA_RS0828550S ribosomal protein L27  [1] (data from MRSA252)
    SA_RS0829550S ribosomal protein L21  [1] (data from MRSA252)
    SA_RS08435trigger factor  [1] (data from MRSA252)
    SA_RS08600universal stress protein  [1] (data from MRSA252)
    SA_RS08760formate--tetrahydrofolate ligase  [1] (data from MRSA252)
    SA_RS09005transaldolase  [1] (data from MRSA252)
    SA_RS11010uracil phosphoribosyltransferase  [1] (data from MRSA252)
    SA_RS11430Asp23/Gls24 family envelope stress response protein  [1] (data from MRSA252)
    SA_RS1160030S ribosomal protein S9  [1] (data from MRSA252)
    SA_RS1163050S ribosomal protein L17  [1] (data from MRSA252)
    SA_RS11660adenylate kinase  [1] (data from MRSA252)
    SA_RS1167050S ribosomal protein L15  [1] (data from MRSA252)
    SA_RS1168030S ribosomal protein S5  [1] (data from MRSA252)
    SA_RS1169050S ribosomal protein L6  [1] (data from MRSA252)
    SA_RS1170550S ribosomal protein L5  [1] (data from MRSA252)
    SA_RS1172030S ribosomal protein S17  [1] (data from MRSA252)
    SA_RS1174530S ribosomal protein S19  [1] (data from MRSA252)
    SA_RS1175050S ribosomal protein L2  [1] (data from MRSA252)
    SA_RS1175550S ribosomal protein L23  [1] (data from MRSA252)
    SA_RS1176050S ribosomal protein L4  [1] (data from MRSA252)
    SA_RS13730class I fructose-bisphosphate aldolase  [1] (data from MRSA252)
    SA_RS13735malate:quinone oxidoreductase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 10
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.094
    • Ymax_pos: 36
    • Cmax: 0.105
    • Cmax_pos: 28
    • Smax: 0.111
    • Smax_pos: 70
    • Smean: 0.074
    • D: 0.087
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446382387 NCBI
  • RefSeq: WP_000460242 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MFDQLDIVEERYEQLNELLSDPDVVNDSDKLRKYSKEQADLQKTVDVYRNYKAKKEELADIEEMLSETDDKEEVEMLKEESNGIKAELPNLEEELKILLIPKDPNDDKDVIVEIRAAAGGDEAAIFAGDLMRMYSKYAESQGFKTEIVEASESDHGGYKEISFSVSGNGAYSKLKFENGAHRVQRVPETESGGRIHTSTATVAVLPEVEDVEIEIRNEDLKIDTYRSSGAGGQHVNTTDSAVRITHLPTGVIATSSEKSQIQNREKAMKVLKARLYDMKVQEEQQKYASQRKSAVGTGDRSERIRTYNYPQSRVTDHRIGLTLQKLGQIMEGHLEEIIDALTLSEQTDKLKELNNGEL

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA_RS11040 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48 1.49 1.50 1.51 1.52 1.53 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]