From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1920 [new locus tag: SA_RS11040 ]
  • pan locus tag?: SAUPAN005409000
  • symbol: prfA
  • pan gene symbol?: prfA
  • synonym:
  • product: peptide chain release factor 1

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1920 [new locus tag: SA_RS11040 ]
  • symbol: prfA
  • product: peptide chain release factor 1
  • replicon: chromosome
  • strand: -
  • coordinates: 2168315..2169391
  • length: 1077
  • essential: yes [1] DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    GTGTTTGATCAATTAGATATTGTAGAAGAAAGATACGAACAGTTAAATGAACTGTTAAGT
    GACCCAGATGTTGTAAATGATTCAGATAAATTACGTAAATATTCTAAAGAGCAAGCTGAT
    TTACAAAAAACTGTAGATGTTTATCGTAACTATAAAGCTAAAAAAGAAGAATTAGCTGAT
    ATTGAAGAAATGTTAAGTGAGACTGATGATAAAGAAGAAGTAGAAATGTTAAAAGAGGAG
    AGTAATGGTATTAAAGCTGAACTTCCAAATCTTGAAGAAGAGCTTAAAATATTATTGATT
    CCTAAAGATCCTAATGATGACAAAGACGTTATTGTAGAAATAAGAGCAGCAGCAGGTGGT
    GATGAGGCTGCGATTTTTGCTGGTGATTTAATGCGTATGTATTCAAAGTATGCTGAATCA
    CAAGGATTCAAAACTGAAATAGTAGAAGCGTCTGAAAGTGACCATGGTGGTTACAAAGAA
    ATTAGTTTCTCAGTTTCTGGTAATGGCGCGTATAGTAAATTGAAATTTGAAAATGGTGCG
    CACCGCGTTCAACGTGTGCCTGAAACAGAATCAGGTGGACGTATTCATACTTCAACAGCT
    ACAGTGGCAGTTTTACCAGAAGTTGAAGATGTAGAAATTGAAATTAGAAATGAAGATTTA
    AAAATCGACACGTATCGTTCAAGTGGTGCAGGTGGTCAGCACGTAAACACAACTGACTCT
    GCAGTACGTATTACCCATTTACCAACTGGTGTCATTGCAACATCTTCTGAGAAGTCTCAA
    ATTCAAAACCGTGAAAAAGCAATGAAAGTGTTAAAAGCACGTTTATACGATATGAAAGTT
    CAAGAAGAACAACAAAAGTATGCGTCACAACGTAAATCAGCAGTCGGTACTGGTGATCGT
    TCAGAACGTATTCGAACTTATAATTATCCACAAAGCCGTGTAACAGACCATCGTATAGGT
    CTAACGCTTCAAAAATTAGGGCAAATTATGGAAGGCCATTTAGAAGAAATTATAGATGCA
    CTGACTTTATCAGAGCAGACAGATAAATTGAAAGAACTTAATAATGGTGAATTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1077

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1920 [new locus tag: SA_RS11040 ]
  • symbol: PrfA
  • description: peptide chain release factor 1
  • length: 358
  • theoretical pI: 4.5415
  • theoretical MW: 40349.6
  • GRAVY: -0.760056

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein synthesisTranslation factorspeptide chain release factor 1 (TIGR00019; HMM-score: 529.5)
    Genetic information processingProtein synthesisTranslation factorspeptide chain release factor 2 (TIGR00020; HMM-score: 300.8)
    Genetic information processingProtein synthesisTranslation factorsputative peptide chain release factor H (TIGR03072; HMM-score: 89.2)
  • TheSEED:  
    Protein MetabolismProtein biosynthesisTranslation termination factors bacterial Peptide chain release factor 1 
    Stress ResponseOxidative stressGlutaredoxins Peptide chain release factor 1 
    LMPTP YwlE cluster Peptide chain release factor 1 
  • PFAM:
    no clan definedPCRF; PCRF domain (PF03462; HMM-score: 248.7)
    RF (CL0337) RF-1; RF-1 domain (PF00472; HMM-score: 135.9)
    no clan definedABC_tran_CTD; ABC transporter C-terminal domain (PF16326; HMM-score: 20.8)
    Trefoil (CL0066) MIR; MIR domain (PF02815; HMM-score: 10.1)
    no clan definedCAF-1_p150; Chromatin assembly factor 1 complex p150 subunit, N-terminal (PF11600; HMM-score: 6.5)
    tRNA_bind_arm (CL0298) Seryl_tRNA_N; Seryl-tRNA synthetase N-terminal domain (PF02403; HMM-score: 6.5)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA0562(adh1)alcohol dehydrogenase  [2] (data from MRSA252)
    SA2027(adk)adenylate kinase  [2] (data from MRSA252)
    SA0366(ahpC)alkyl hydroperoxide reductase  [2] (data from MRSA252)
    SA1984(asp23)alkaline shock protein 23  [2] (data from MRSA252)
    SA0471(cysK)hypothetical protein  [2] (data from MRSA252)
    SA0731(eno)phosphopyruvate hydratase  [2] (data from MRSA252)
    SA1553(fhs)formate--tetrahydrofolate ligase  [2] (data from MRSA252)
    SA1029(ftsZ)cell division protein FtsZ  [2] (data from MRSA252)
    SA0727(gap)glyceraldehyde-3-phosphate dehydrogenase  [2] (data from MRSA252)
    SA1716(gatA)aspartyl/glutamyl-tRNA amidotransferase subunit A  [2] (data from MRSA252)
    SA1150(glnA)glutamine-ammonia ligase  [2] (data from MRSA252)
    SA1342(gnd)6-phosphogluconate dehydrogenase  [2] (data from MRSA252)
    SA1305(hu)DNA-binding protein II  [2] (data from MRSA252)
    SA2400(mqo2)malate:quinone oxidoreductase  [2] (data from MRSA252)
    SA1244(odhB)dihydrolipoamide succinyltransferase  [2] (data from MRSA252)
    SA0943-1(pdhA)pyruvate dehydrogenase E1 component subunit alpha  [2] (data from MRSA252)
    SA0944(pdhB)pyruvate dehydrogenase E1 component subunit beta  [2] (data from MRSA252)
    SA0218(pflB)formate acetyltransferase  [2] (data from MRSA252)
    SA0728(pgk)phosphoglycerate kinase  [2] (data from MRSA252)
    SA0934(ptsH)phosphocarrier protein HPr  [2] (data from MRSA252)
    SA0496(rplA)50S ribosomal protein L1  [2] (data from MRSA252)
    SA2044(rplB)50S ribosomal protein L2  [2] (data from MRSA252)
    SA2046(rplD)50S ribosomal protein L4  [2] (data from MRSA252)
    SA2035(rplE)50S ribosomal protein L5  [2] (data from MRSA252)
    SA2033(rplF)50S ribosomal protein L6  [2] (data from MRSA252)
    SA0497(rplJ)50S ribosomal protein L10  [2] (data from MRSA252)
    SA0498(rplL)50S ribosomal protein L7/L12  [2] (data from MRSA252)
    SA2029(rplO)50S ribosomal protein L15  [2] (data from MRSA252)
    SA2022(rplQ)50S ribosomal protein L17  [2] (data from MRSA252)
    SA1473(rplU)50S ribosomal protein L21  [2] (data from MRSA252)
    SA2045(rplW)50S ribosomal protein L23  [2] (data from MRSA252)
    SA0459(rplY)50S ribosomal protein L25  [2] (data from MRSA252)
    SA1471(rpmA)50S ribosomal protein L27  [2] (data from MRSA252)
    SA1099(rpsB)30S ribosomal protein S2  [2] (data from MRSA252)
    SA2031(rpsE)30S ribosomal protein S5  [2] (data from MRSA252)
    SA0352(rpsF)30S ribosomal protein S6  [2] (data from MRSA252)
    SA0504(rpsG)30S ribosomal protein S7  [2] (data from MRSA252)
    SA2016(rpsI)30S ribosomal protein S9  [2] (data from MRSA252)
    SA1081(rpsP)30S ribosomal protein S16  [2] (data from MRSA252)
    SA2038(rpsQ)30S ribosomal protein S17  [2] (data from MRSA252)
    SA2043(rpsS)30S ribosomal protein S19  [2] (data from MRSA252)
    SA1414(rpsT)30S ribosomal protein S20  [2] (data from MRSA252)
    SA1089(sucD)succinyl-CoA synthetase subunit alpha  [2] (data from MRSA252)
    SA1499(tig)trigger factor  [2] (data from MRSA252)
    SA0729(tpiA)triosephosphate isomerase  [2] (data from MRSA252)
    SA0992(trxA)thioredoxin  [2] (data from MRSA252)
    SA1100(tsf)elongation factor Ts  [2] (data from MRSA252)
    SA1914(upp)uracil phosphoribosyltransferase  [2] (data from MRSA252)
    SA0422hypothetical protein  [2] (data from MRSA252)
    SA0477pyridoxal biosynthesis lyase PdxS  [2] (data from MRSA252)
    SA0802hypothetical protein  [2] (data from MRSA252)
    SA1528hypothetical protein  [2] (data from MRSA252)
    SA1599translaldolase  [2] (data from MRSA252)
    SA2399fructose-1,6-bisphosphate aldolase  [2] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 10
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.094
    • Ymax_pos: 36
    • Cmax: 0.105
    • Cmax_pos: 28
    • Smax: 0.111
    • Smax_pos: 70
    • Smean: 0.074
    • D: 0.087
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MFDQLDIVEERYEQLNELLSDPDVVNDSDKLRKYSKEQADLQKTVDVYRNYKAKKEELADIEEMLSETDDKEEVEMLKEESNGIKAELPNLEEELKILLIPKDPNDDKDVIVEIRAAAGGDEAAIFAGDLMRMYSKYAESQGFKTEIVEASESDHGGYKEISFSVSGNGAYSKLKFENGAHRVQRVPETESGGRIHTSTATVAVLPEVEDVEIEIRNEDLKIDTYRSSGAGGQHVNTTDSAVRITHLPTGVIATSSEKSQIQNREKAMKVLKARLYDMKVQEEQQKYASQRKSAVGTGDRSERIRTYNYPQSRVTDHRIGLTLQKLGQIMEGHLEEIIDALTLSEQTDKLKELNNGEL

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. R Allyn Forsyth, Robert J Haselbeck, Kari L Ohlsen, Robert T Yamamoto, Howard Xu, John D Trawick, Daniel Wall, Liangsu Wang, Vickie Brown-Driver, Jamie M Froelich, Kedar G C, Paula King, Melissa McCarthy, Cheryl Malone, Brian Misiner, David Robbins, Zehui Tan, Zhan-yang Zhu Zy, Grant Carr, Deborah A Mosca, Carlos Zamudio, J Gordon Foulkes, Judith W Zyskind
    A genome-wide strategy for the identification of essential genes in Staphylococcus aureus.
    Mol. Microbiol.: 2002, 43(6);1387-400
    [PubMed:11952893] [WorldCat.org] (P p)
  2. 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 2.19 2.20 2.21 2.22 2.23 2.24 2.25 2.26 2.27 2.28 2.29 2.30 2.31 2.32 2.33 2.34 2.35 2.36 2.37 2.38 2.39 2.40 2.41 2.42 2.43 2.44 2.45 2.46 2.47 2.48 2.49 2.50 2.51 2.52 2.53 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]