Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL1221 [new locus tag: SACOL_RS06255 ]
- pan locus tag?: SAUPAN003491000
- symbol: gmk
- pan gene symbol?: gmk
- synonym:
- product: guanylate kinase
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL1221 [new locus tag: SACOL_RS06255 ]
- symbol: gmk
- product: guanylate kinase
- replicon: chromosome
- strand: +
- coordinates: 1230617..1231240
- length: 624
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3236139 NCBI
- RefSeq: YP_186084 NCBI
- BioCyc:
- MicrobesOnline: 912689 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601ATGGATAATGAAAAAGGATTGTTAATCGTTTTATCAGGACCATCTGGAGTAGGTAAAGGT
ACTGTTAGAAAACGAATATTTGAAGATCCAAGTACATCATATAAGTATTCTATTTCAATG
ACAACACGTCAAATGCGTGAAGGTGAAGTTGATGGCGTAGATTACTTTTTTAAAACTAGG
GATGCGTTTGAAGCTTTAATCAAAGATGACCAATTTATAGAATATGCTGAATATGTAGGC
AACTATTATGGTACACCAGTTCAATATGTTAAAGATACAATGGACGAAGGTCATGATGTA
TTTTTAGAAATTGAAGTAGAAGGTGCAAAGCAAGTTAGAAAGAAATTTCCAGATGCGCTA
TTTATTTTCTTAGCACCTCCAAGTTTAGAACACTTGAGAGAGCGATTAGTAGGTAGAGGA
ACAGAATCTGATGAGAAAATACAAAGTCGTATTAACGAAGCGCGTAAAGAAGTTGAAATG
ATGAATTTATACGATTACGTTGTAGTTAATGATGAAGTAGAACTTGCGAAGAATAGAATT
CAATGTATTGTAGAAGCTGAGCACTTAAAAAGAGAGCGCGTAGAAGCTAAGTATAGAAAA
ATGATTTTGGAGGCTAAAAAATAA60
120
180
240
300
360
420
480
540
600
624
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL1221 [new locus tag: SACOL_RS06255 ]
- symbol: Gmk
- description: guanylate kinase
- length: 207
- theoretical pI: 5.10267
- theoretical MW: 24037.2
- GRAVY: -0.579227
⊟Function[edit | edit source]
- reaction: EC 2.7.4.8? ExPASyGuanylate kinase ATP + GMP = ADP + GDP
- TIGRFAM: Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions guanylate kinase (TIGR03263; EC 2.7.4.8; HMM-score: 238.9)and 5 moreCentral intermediary metabolism Phosphorus compounds phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN (TIGR02322; HMM-score: 47.8)Biosynthesis of cofactors, prosthetic groups, and carriers Pantothenate and coenzyme A dephospho-CoA kinase (TIGR00152; EC 2.7.1.24; HMM-score: 19)putative cytidylate kinase (TIGR02173; EC 2.7.4.14; HMM-score: 14.1)Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions adenylate kinase (TIGR01351; EC 2.7.4.-; HMM-score: 13.5)phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 12.4)
- TheSEED:
- PFAM: P-loop_NTPase (CL0023) Guanylate_kin; Guanylate kinase (PF00625; HMM-score: 172.1)and 9 moreAAA_18; AAA domain (PF13238; HMM-score: 19.7)MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 14.3)AAA_16; AAA ATPase domain (PF13191; HMM-score: 14.3)AAA_17; AAA domain (PF13207; HMM-score: 14.1)AAA_22; AAA domain (PF13401; HMM-score: 14.1)AAA_33; AAA domain (PF13671; HMM-score: 13.8)ABC_tran; ABC transporter (PF00005; HMM-score: 13.6)no clan defined YtxH; YtxH-like protein (PF12732; HMM-score: 13.2)P-loop_NTPase (CL0023) RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 11.9)
⊟Structure, modifications & interactions[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
- protein partners:
SACOL0842 (eno) phosphopyruvate hydratase [1] (data from MRSA252) SACOL1245 (fabG1) 3-oxoacyl-ACP reductase [1] (data from MRSA252) SACOL2117 (fbaA) fructose-bisphosphate aldolase [1] (data from MRSA252) SACOL1329 (femC) glutamine synthetase [1] (data from MRSA252) SACOL1072 (folD) bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase [1] (data from MRSA252) SACOL1199 (ftsZ) cell division protein FtsZ [1] (data from MRSA252) SACOL0838 (gapA1) glyceraldehyde 3-phosphate dehydrogenase [1] (data from MRSA252) SACOL1622 (glyS) glycyl-tRNA synthetase [1] (data from MRSA252) SACOL2016 (groEL) chaperonin GroEL [1] (data from MRSA252) SACOL1741 (icd) isocitrate dehydrogenase [1] (data from MRSA252) SACOL1206 (ileS) isoleucyl-tRNA synthetase [1] (data from MRSA252) SACOL0222 (ldh1) L-lactate dehydrogenase [1] (data from MRSA252) SACOL2623 (mqo2) malate:quinone oxidoreductase [1] (data from MRSA252) SACOL1005 (pepF) oligoendopeptidase F [1] (data from MRSA252) SACOL0966 (pgi) glucose-6-phosphate isomerase [1] (data from MRSA252) SACOL0841 (pgm) phosphoglyceromutase [1] (data from MRSA252) SACOL1091 (ptsH) phosphocarrier protein HPr [1] (data from MRSA252) SACOL0585 (rplJ) 50S ribosomal protein L10 [1] (data from MRSA252) SACOL0586 (rplL) 50S ribosomal protein L7/L12 [1] (data from MRSA252) SACOL2220 (rplO) 50S ribosomal protein L15 [1] (data from MRSA252) SACOL2212 (rplQ) 50S ribosomal protein L17 [1] (data from MRSA252) SACOL2234 (rplV) 50S ribosomal protein L22 [1] (data from MRSA252) SACOL1516 (rpsA) 30S ribosomal protein S1 [1] (data from MRSA252) SACOL0437 (rpsF) 30S ribosomal protein S6 [1] (data from MRSA252) SACOL2206 (rpsI) 30S ribosomal protein S9 [1] (data from MRSA252) SACOL1449 (sucA) 2-oxoglutarate dehydrogenase E1 component [1] (data from MRSA252) SACOL1262 (sucC) succinyl-CoA synthetase subunit beta [1] (data from MRSA252) SACOL1155 (trxA) thioredoxin [1] (data from MRSA252) SACOL0426 acetyl-CoA acetyltransferase [1] (data from MRSA252) SACOL0564 pyridoxal biosynthesis lyase PdxS [1] (data from MRSA252) SACOL0731 LysR family transcriptional regulator [1] (data from MRSA252) SACOL1020 hypothetical protein [1] (data from MRSA252) SACOL1670 hypothetical protein [1] (data from MRSA252)
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.006276
- TAT(Tat/SPI): 0.000768
- LIPO(Sec/SPII): 0.002138
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MDNEKGLLIVLSGPSGVGKGTVRKRIFEDPSTSYKYSISMTTRQMREGEVDGVDYFFKTRDAFEALIKDDQFIEYAEYVGNYYGTPVQYVKDTMDEGHDVFLEIEVEGAKQVRKKFPDALFIFLAPPSLEHLRERLVGRGTESDEKIQSRINEARKEVEMMNLYDYVVVNDEVELAKNRIQCIVEAEHLKRERVEAKYRKMILEAKK
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlasquantitative data / protein copy number per cell: 621 [5]
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: 29.54 h [6]
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32
Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p) - ↑
Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
PLoS One: 2009, 4(12);e8176
[PubMed:19997597] [WorldCat.org] [DOI] (I e) - ↑
Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
J Proteome Res: 2011, 10(4);1657-66
[PubMed:21323324] [WorldCat.org] [DOI] (I p) - ↑
Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
The Staphylococcus aureus proteome.
Int J Med Microbiol: 2014, 304(2);110-20
[PubMed:24439828] [WorldCat.org] [DOI] (I p) - ↑
Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
Sci Rep: 2016, 6;28172
[PubMed:27344979] [WorldCat.org] [DOI] (I e) - ↑
Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
Mol Cell Proteomics: 2012, 11(9);558-70
[PubMed:22556279] [WorldCat.org] [DOI] (I p)
⊟Relevant publications[edit | edit source]
Kamel El Omari, Balvinder Dhaliwal, Michael Lockyer, Ian Charles, Alastair R Hawkins, David K Stammers
Structure of Staphylococcus aureus guanylate monophosphate kinase.
Acta Crystallogr Sect F Struct Biol Cryst Commun: 2006, 62(Pt 10);949-53
[PubMed:17012781] [WorldCat.org] [DOI] (I p)