From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL2713 [new locus tag: SACOL_RS14190 ]
  • pan locus tag?: SAUPAN006446000
  • symbol: SACOL2713
  • pan gene symbol?:
  • synonym:
  • product: hypothetical protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL2713 [new locus tag: SACOL_RS14190 ]
  • symbol: SACOL2713
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 2785561..2786517
  • length: 957
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    ATGAACTATCAAGTTCTTTTATATTATAAATATATGACGATTGATGACCCTGAACAGTTT
    GCTCAGGATCACTTAGCCTTTTGTAAAGCACACCATTTAAAAGGTAGAATTCTTGTTTCT
    ACAGAAGGTATTAACGGCACATTATCTGGTACAAAAGAAGAAACCGAACAATATATGGCA
    CATATGCATGCCGATGAACGATTCAAAGATATGGTGTTTAAAATTGATGAAGCTGAAGGA
    CATGCTTTTAAGAAAATGCATGTACGTCCTCGAAAAGAAATCGTTGCTTTAGATTTAGAA
    GATGACGTCGATCCAAGACACACAACTGGCCAATATTTATCACCTGTAGAATTTAGAAAA
    GCTCTTGAAGATGATGACACAGTCATTATTGATGCACGTAATGATTATGAATTTGATTTA
    GGTCATTTCCGAGGTGCAATTCGTCCAAATATCACACGTTTTAGAGATTTGCCTGACTGG
    ATTAAAGAGAATAAAGCGTTATTTGCAGATAAAAAAGTGGTTACGTACTGTACTGGTGGC
    ATTCGATGCGAAAAATTTTCTGGATGGCTTTTAAAAGAAGGTTTCGAAGATGTAGCTCAA
    CTTCATGGCGGTATTGCTACATATGGTAAAGATCCTGAAACAAAAAGTGAATATTGGGAC
    GGTAAAATGTACGTATTTGATGACCGTATCAGTGTTGATATCAACCAAGTTGAAAAAACA
    ATTATTGGTAAGGATTGGTTTGATGGCAAACCATGTGAACGTTATATTAATTGCGCTAAC
    CCAGAATGTAATAAACAAATATTAGTTTCTGAAGAAAACGAAACTAAATATTTAGGTGCA
    TGCTCTTATGAATGTGCTAAACATGAGCGTAATCGTTATGTTCAAGCAAATAATATTAGT
    GATAATGAGTGGCAACAACGTTTAACAAACTTTGATGATTTACATCAACATGCTTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    957

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL2713 [new locus tag: SACOL_RS14190 ]
  • symbol: SACOL2713
  • description: hypothetical protein
  • length: 318
  • theoretical pI: 5.18797
  • theoretical MW: 37087.3
  • GRAVY: -0.746855

Function[edit | edit source]

  • TIGRFAM:
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA 2-selenouridine synthase (TIGR03167; EC 2.9.1.-; HMM-score: 18)
    Cys-rich protein, LA_1312 family (TIGR04453; HMM-score: 15.3)
    and 1 more
    Genetic information processing DNA metabolism DNA replication, recombination, and repair replication factor-a protein 1 (rpa1) (TIGR00617; HMM-score: 4.3)
  • TheSEED  :
    • Rhodanese domain protein UPF0176, Firmicutes subgroup
  • PFAM:
    no clan defined Rhodanese_C; Rhodanase C-terminal (PF12368; HMM-score: 58.5)
    and 3 more
    Phosphatase (CL0031) Rhodanese; Rhodanese-like domain (PF00581; HMM-score: 44.8)
    OB (CL0021) Rep_fac-A_C; Replication factor-A C terminal domain (PF08646; HMM-score: 15.7)
    CCCH_zf (CL0537) zf-CCCH_2; RNA-binding, Nab2-type zinc finger (PF14608; HMM-score: 9.4)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.006325
    • TAT(Tat/SPI): 0.00023
    • LIPO(Sec/SPII): 0.000638
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MNYQVLLYYKYMTIDDPEQFAQDHLAFCKAHHLKGRILVSTEGINGTLSGTKEETEQYMAHMHADERFKDMVFKIDEAEGHAFKKMHVRPRKEIVALDLEDDVDPRHTTGQYLSPVEFRKALEDDDTVIIDARNDYEFDLGHFRGAIRPNITRFRDLPDWIKENKALFADKKVVTYCTGGIRCEKFSGWLLKEGFEDVAQLHGGIATYGKDPETKSEYWDGKMYVFDDRISVDINQVEKTIIGKDWFDGKPCERYINCANPECNKQILVSEENETKYLGACSYECAKHERNRYVQANNISDNEWQQRLTNFDDLHQHA

Experimental data[edit | edit source]

  • experimentally validated: data available for NCTC8325
  • protein localization: Cytoplasmic [1]
  • quantitative data / protein copy number per cell: 32 [2]
  • interaction partners:
    SACOL0557(cysK)cysteine synthase  [3] (data from MRSA252)
    SACOL0123(deoC1)deoxyribose-phosphate aldolase  [3] (data from MRSA252)
    SACOL2130(deoD)purine nucleoside phosphorylase  [3] (data from MRSA252)
    SACOL0634(eutD)phosphotransacetylase  [3] (data from MRSA252)
    SACOL1245(fabG1)3-oxoacyl-ACP reductase  [3] (data from MRSA252)
    SACOL2117(fbaA)fructose-bisphosphate aldolase  [3] (data from MRSA252)
    SACOL2622(fdaB)fructose-1,6-bisphosphate aldolase  [3] (data from MRSA252)
    SACOL1329(femC)glutamine synthetase  [3] (data from MRSA252)
    SACOL0838(gapA1)glyceraldehyde 3-phosphate dehydrogenase  [3] (data from MRSA252)
    SACOL2016(groEL)chaperonin GroEL  [3] (data from MRSA252)
    SACOL1741(icd)isocitrate dehydrogenase  [3] (data from MRSA252)
    SACOL0793(nrdF)ribonucleotide-diphosphate reductase subunit beta  [3] (data from MRSA252)
    SACOL0966(pgi)glucose-6-phosphate isomerase  [3] (data from MRSA252)
    SACOL1091(ptsH)phosphocarrier protein HPr  [3] (data from MRSA252)
    SACOL1092(ptsI)phosphoenolpyruvate-protein phosphotransferase  [3] (data from MRSA252)
    SACOL2238(rplD)50S ribosomal protein L4  [3] (data from MRSA252)
    SACOL0585(rplJ)50S ribosomal protein L10  [3] (data from MRSA252)
    SACOL0583(rplK)50S ribosomal protein L11  [3] (data from MRSA252)
    SACOL2220(rplO)50S ribosomal protein L15  [3] (data from MRSA252)
    SACOL0589(rpoC)DNA-directed RNA polymerase subunit beta'  [3] (data from MRSA252)
    SACOL2120(rpoE)DNA-directed RNA polymerase subunit delta  [3] (data from MRSA252)
    SACOL1274(rpsB)30S ribosomal protein S2  [3] (data from MRSA252)
    SACOL2222(rpsE)30S ribosomal protein S5  [3] (data from MRSA252)
    SACOL2206(rpsI)30S ribosomal protein S9  [3] (data from MRSA252)
    SACOL1263(sucD)succinyl-CoA synthetase subunit alpha  [3] (data from MRSA252)
    SACOL1831(tal)translaldolase  [3] (data from MRSA252)
    SACOL0840(tpiA)triosephosphate isomerase  [3] (data from MRSA252)
    SACOL1762(tpx)thiol peroxidase  [3] (data from MRSA252)
    SACOL1155(trxA)thioredoxin  [3] (data from MRSA252)
    SACOL1276(tsf)elongation factor Ts  [3] (data from MRSA252)
    SACOL0594(tuf)elongation factor Tu  [3] (data from MRSA252)
    SACOL0564pyridoxal biosynthesis lyase PdxS  [3] (data from MRSA252)
    SACOL0944NADH dehydrogenase  [3] (data from MRSA252)
    SACOL1020hypothetical protein  [3] (data from MRSA252)
    SACOL1952ferritins family protein  [3] (data from MRSA252)

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

  • SACOL2713 no polycistronic organisation predicted

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  2. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  3. 3.00 3.01 3.02 3.03 3.04 3.05 3.06 3.07 3.08 3.09 3.10 3.11 3.12 3.13 3.14 3.15 3.16 3.17 3.18 3.19 3.20 3.21 3.22 3.23 3.24 3.25 3.26 3.27 3.28 3.29 3.30 3.31 3.32 3.33 3.34 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]