From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS03155 [old locus tag: SA0545 ]
  • pan locus tag?: SAUPAN002368000
  • symbol: SA_RS03155
  • pan gene symbol?: pta
  • synonym:
  • product: phosphate acetyltransferase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA_RS03155 [old locus tag: SA0545 ]
  • symbol: SA_RS03155
  • product: phosphate acetyltransferase
  • replicon: chromosome
  • strand: +
  • coordinates: 638340..639326
  • length: 987
  • essential: yes [1] DEG other strains

Accession numbers[edit | edit source]

  • Location: NC_002745 (638340..639326) NCBI
  • BioCyc: G1G21-619 BioCyc
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    ATGGCTGATTTATTAAATGTATTAAAAGACAAACTTTCTGGTAAAAACGTTAAAATCGTA
    TTACCTGAAGGAGAGGACGAACGTGTTCTAACAGCTGCAACACAATTACAAGCAACAGAT
    TATGTTACACCAATCGTGTTAGGTGATGAGACTAAGGTTCAATCTTTAGCGCAAAAACTT
    GATCTTGATATTTCTAATATTGAATTAATTAATCCTGCGACAAGTGAATTGAAAGCTGAA
    TTAGTTCAATCATTTGTTGAACGACGTAAAGGTAAAGCGACTGAAGAACAAGCACAAGAA
    TTATTAAACAATGTGAACTACTTCGGTACAATGCTTGTTTATGCTGGTAAAGCAGATGGT
    TTAGTTAGTGGTGCAGCACATTCAACAGGAGACACTGTGCGTCCAGCTTTACAAATCATC
    AAAACGAAACCAGGTGTATCAAGAACATCAGGTATCTTCTTTATGATTAAAGGTGATGAA
    CAATACATCTTTGGTGATTGTGCAATCAATCCAGAACTTGATTCACAAGGACTTGCAGAA
    ATTGCAGTAGAAAGTGCAAAATCAGCATTAAGCTTTGGCATGGATCCAAAAGTTGCAATG
    TTAAGCTTTTCAACAAAAGGGTCTGCTAAATCAGACGACGTGACAAAAGTTCAAGAAGCT
    GTCAAATTAGCACAACAAAAAGCTGAAGAAGAAAAATTAGAAGCAATCATTGATGGCGAA
    TTCCAATTTGATGCTGCGATTGTACCAGGTGTTGCTGAGAAAAAAGCGCCAGGTGCTAAA
    TTACAAGGTGATGCAAATGTCTTTGTATTCCCAAGTTTAGAAGCTGGTAATATTGGTTAC
    AAAATTGCACAACGTTTAGGTGGATATGATGCAGTTGGTCCAGTATTACAAGGTTTAAAT
    TCTCCAGTAAATGACTTATCACGTGGCTGCTCAATTGAAGATGTATACAATCTTTCAATT
    ATTACAGCAGCGCAAGCCTTACAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    987

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA_RS03155 [old locus tag: SA0545 ]
  • symbol: SA_RS03155
  • description: phosphate acetyltransferase
  • length: 328
  • theoretical pI: 4.45699
  • theoretical MW: 34951.5
  • GRAVY: -0.0859756

Function[edit | edit source]

  • reaction:
    EC 2.3.1.8?  ExPASy
    Phosphate acetyltransferase Acetyl-CoA + phosphate = CoA + acetyl phosphate
  • TIGRFAM:
    Metabolism Energy metabolism Fermentation phosphate acetyltransferase (TIGR00651; EC 2.3.1.8; HMM-score: 390.2)
    Metabolism Central intermediary metabolism Other phosphate acetyltransferase (TIGR00651; EC 2.3.1.8; HMM-score: 390.2)
    and 2 more
    Metabolism Energy metabolism Fermentation phosphate butyryltransferase (TIGR02706; EC 2.3.1.19; HMM-score: 70.5)
    Metabolism Energy metabolism Amino acids and amines branched-chain phosphotransacylase (TIGR02709; EC 2.3.1.-; HMM-score: 38.6)
  • TheSEED:
  • PFAM:
    Iso_DH (CL0270) PTA_PTB; Phosphate acetyl/butaryl transferase (PF01515; HMM-score: 397.6)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA_RS11130(deoA)pyrimidine-nucleoside phosphorylase  [2] (data from MRSA252)
    SA_RS09855(gatA)glutamyl-tRNA(Gln) amidotransferase subunit A  [2] (data from MRSA252)
    SA_RS00310aminoglycoside O-nucleotidyltransferase ANT(4')-Ia  [2] (data from MRSA252)
    SA_RS00690immunoglobulin G-binding protein A  [2] (data from MRSA252)
    SA_RS01275formate acetyltransferase  [2] (data from MRSA252)
    SA_RS01365L-lactate dehydrogenase  [2] (data from MRSA252)
    SA_RS02005GTP-binding protein YchF  [2] (data from MRSA252)
    SA_RS0201530S ribosomal protein S6  [2] (data from MRSA252)
    SA_RS0202530S ribosomal protein S18  [2] (data from MRSA252)
    SA_RS02095alkyl hydroperoxide reductase subunit C  [2] (data from MRSA252)
    SA_RS0290550S ribosomal protein L11  [2] (data from MRSA252)
    SA_RS0291050S ribosomal protein L1  [2] (data from MRSA252)
    SA_RS0291550S ribosomal protein L10  [2] (data from MRSA252)
    SA_RS02930DNA-directed RNA polymerase subunit beta  [2] (data from MRSA252)
    SA_RS02935DNA-directed RNA polymerase subunit beta'  [2] (data from MRSA252)
    SA_RS02955elongation factor G  [2] (data from MRSA252)
    SA_RS02960elongation factor Tu  [2] (data from MRSA252)
    SA_RS04575NADH dehydrogenase  [2] (data from MRSA252)
    SA_RS04710hypothetical protein  [2] (data from MRSA252)
    SA_RS04915enoyl-ACP reductase  [2] (data from MRSA252)
    SA_RS05190bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase  [2] (data from MRSA252)
    SA_RS05350pyruvate dehydrogenase E1 component subunit alpha  [2] (data from MRSA252)
    SA_RS05355pyruvate dehydrogenase E1 component subunit beta  [2] (data from MRSA252)
    SA_RS05360dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex  [2] (data from MRSA252)
    SA_RS05365dihydrolipoyl dehydrogenase  [2] (data from MRSA252)
    SA_RS05860cell division protein FtsZ  [2] (data from MRSA252)
    SA_RS0614050S ribosomal protein L19  [2] (data from MRSA252)
    SA_RS0622530S ribosomal protein S2  [2] (data from MRSA252)
    SA_RS06295translation initiation factor IF-2  [2] (data from MRSA252)
    SA_RS06950virulence factor B  [2] (data from MRSA252)
    SA_RS07060dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex  [2] (data from MRSA252)
    SA_RS070652-oxoglutarate dehydrogenase E1 component  [2] (data from MRSA252)
    SA_RS07385DNA-binding protein HU  [2] (data from MRSA252)
    SA_RS07955molecular chaperone DnaK  [2] (data from MRSA252)
    SA_RS0829550S ribosomal protein L21  [2] (data from MRSA252)
    SA_RS0846050S ribosomal protein L20  [2] (data from MRSA252)
    SA_RS08470translation initiation factor IF-3  [2] (data from MRSA252)
    SA_RS08505aldehyde dehydrogenase  [2] (data from MRSA252)
    SA_RS08545isocitrate dehydrogenase (NADP(+))  [2] (data from MRSA252)
    SA_RS08560pyruvate kinase  [2] (data from MRSA252)
    SA_RS08625universal stress protein UspA  [2] (data from MRSA252)
    SA_RS0867530S ribosomal protein S4  [2] (data from MRSA252)
    SA_RS10050hypothetical protein  [2] (data from MRSA252)
    SA_RS10765serine phosphatase  [2] (data from MRSA252)
    SA_RS11070UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [2] (data from MRSA252)
    SA_RS11430Asp23/Gls24 family envelope stress response protein  [2] (data from MRSA252)
    SA_RS1160030S ribosomal protein S9  [2] (data from MRSA252)
    SA_RS1164030S ribosomal protein S11  [2] (data from MRSA252)
    SA_RS1164530S ribosomal protein S13  [2] (data from MRSA252)
    SA_RS1167050S ribosomal protein L15  [2] (data from MRSA252)
    SA_RS1168030S ribosomal protein S5  [2] (data from MRSA252)
    SA_RS1168550S ribosomal protein L18  [2] (data from MRSA252)
    SA_RS1170550S ribosomal protein L5  [2] (data from MRSA252)
    SA_RS1171550S ribosomal protein L14  [2] (data from MRSA252)
    SA_RS1173530S ribosomal protein S3  [2] (data from MRSA252)
    SA_RS1174050S ribosomal protein L22  [2] (data from MRSA252)
    SA_RS1174530S ribosomal protein S19  [2] (data from MRSA252)
    SA_RS1175050S ribosomal protein L2  [2] (data from MRSA252)
    SA_RS1175550S ribosomal protein L23  [2] (data from MRSA252)
    SA_RS1176050S ribosomal protein L4  [2] (data from MRSA252)
    SA_RS1176550S ribosomal protein L3  [2] (data from MRSA252)
    SA_RS11925molybdate ABC transporter substrate-binding protein  [2] (data from MRSA252)
    SA_RS12040octopine dehydrogenase  [2] (data from MRSA252)
    SA_RS13340pyruvate oxidase  [2] (data from MRSA252)
    SA_RS13375hydroxymethylglutaryl-CoA synthase  [2] (data from MRSA252)
    SA_RS13735malate:quinone oxidoreductase  [2] (data from MRSA252)

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.002103
    • TAT(Tat/SPI): 0.00028
    • LIPO(Sec/SPII): 0.000266
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 446696935 NCBI
  • RefSeq: WP_000774281 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MADLLNVLKDKLSGKNVKIVLPEGEDERVLTAATQLQATDYVTPIVLGDETKVQSLAQKLDLDISNIELINPATSELKAELVQSFVERRKGKATEEQAQELLNNVNYFGTMLVYAGKADGLVSGAAHSTGDTVRPALQIIKTKPGVSRTSGIFFMIKGDEQYIFGDCAINPELDSQGLAEIAVESAKSALSFGMDPKVAMLSFSTKGSAKSDDVTKVQEAVKLAQQKAEEEKLEAIIDGEFQFDAAIVPGVAEKKAPGAKLQGDANVFVFPSLEAGNIGYKIAQRLGGYDAVGPVLQGLNSPVNDLSRGCSIEDVYNLSIITAAQALQ

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. R Allyn Forsyth, Robert J Haselbeck, Kari L Ohlsen, Robert T Yamamoto, Howard Xu, John D Trawick, Daniel Wall, Liangsu Wang, Vickie Brown-Driver, Jamie M Froelich, Kedar G C, Paula King, Melissa McCarthy, Cheryl Malone, Brian Misiner, David Robbins, Zehui Tan, Zhan-yang Zhu Zy, Grant Carr, Deborah A Mosca, Carlos Zamudio, J Gordon Foulkes, Judith W Zyskind
    A genome-wide strategy for the identification of essential genes in Staphylococcus aureus.
    Mol Microbiol: 2002, 43(6);1387-400
    [PubMed:11952893] [WorldCat.org] [DOI] (P p)
  2. 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 2.19 2.20 2.21 2.22 2.23 2.24 2.25 2.26 2.27 2.28 2.29 2.30 2.31 2.32 2.33 2.34 2.35 2.36 2.37 2.38 2.39 2.40 2.41 2.42 2.43 2.44 2.45 2.46 2.47 2.48 2.49 2.50 2.51 2.52 2.53 2.54 2.55 2.56 2.57 2.58 2.59 2.60 2.61 2.62 2.63 2.64 2.65 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]