From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_1180 [new locus tag: NWMN_RS06655 ]
  • pan locus tag?: SAUPAN003572000
  • symbol: truB
  • pan gene symbol?: truB
  • synonym:
  • product: tRNA pseudouridine synthase B

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_1180 [new locus tag: NWMN_RS06655 ]
  • symbol: truB
  • product: tRNA pseudouridine synthase B
  • replicon: chromosome
  • strand: +
  • coordinates: 1299390..1300307
  • length: 918
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    ATGTATAATGGGATATTACCAGTATATAAAGAGCGCGGTTTAACAAGTCATGACGTTGTA
    TTCAAATTGCGTAAAATATTAAAAACTAAAAAAATAGGTCACACGGGTACGCTTGATCCC
    GAAGTTGCAGGCGTGTTACCGGTATGTATAGGTAATGCAACGAGAGTTAGTGATTATGTT
    ATGGATATGGGCAAAGCTTATGAAGCAACTGTATCGATAGGAAGAAGTACAACGACTGAA
    GATCAAACGGGTGATACATTGGAAACAAAAGGTGTACACTCAGCAGATTTTAATAAGGAC
    GATATTGACCGATTGTTAGAAAGTTTTAAAGGTATCATTGAACAAATTCCGCCGATGTAC
    TCATCCGTCAAAGTAAATGGTAAAAAATTATATGAATATGCGCGTAATAATGAAACAGTT
    GAAAGACCAAAGCGTAAAGTTAATATTAAAGACATTGGGCGTATATCTGAATTAGATTTT
    AAAGAAAATGAGTGTCATTTTAAAATACGCGTCATCTGTGGTAAAGGTACATATATTAGA
    ACGCTAGCAACTGATATTGGTGTGAAATTAGGCTTTCCGGCACATATGTCGAAATTAACA
    CGAATCGAGTCTGGTGGATTTGTGTTGAAAGATAGCCTTACATTAGAACAAATAAAAGAA
    CTTCATGAGCAGGATTCATTGCAAAATAAATTGTTTCCTTTAGAATATGGATTAAAGGGT
    TTGCCAAGCATTAAAATTAAAGATTCGCACATAAAAAAACGTATTTTAAATGGGCAGAAA
    TTTAATAAAAATGAATTTGATAACAAAATTAAAGACCAAATTGTATTTATTGATGATGAT
    TCAGAAAAAGTATTAGCAATTTATATGGTACACCCTACAAAAGAATCAGAAATTAAACCT
    AAAAAAGTCTTTAATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    918

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_1180 [new locus tag: NWMN_RS06655 ]
  • symbol: TruB
  • description: tRNA pseudouridine synthase B
  • length: 305
  • theoretical pI: 9.56269
  • theoretical MW: 34592.7
  • GRAVY: -0.48918

Function[edit source | edit]

  • reaction:
    EC 5.4.99.25?  ExPASy
    tRNA pseudouridine55 synthasetRNA uridine55 = tRNA pseudouridine55
  • TIGRFAM:
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA pseudouridine(55) synthase (TIGR00431; EC 5.4.99.25; HMM-score: 249)
    Genetic information processingProtein synthesistRNA and rRNA base modificationputative rRNA pseudouridine synthase (TIGR00425; EC 5.4.99.-; HMM-score: 134.3)
    MetabolismTransport and binding proteinsCations and iron carrying compoundstonB-system energizer ExbB (TIGR02805; HMM-score: 11.8)
  • TheSEED:  
    RNA MetabolismRNA processing and modificationtRNA processing tRNA pseudouridine synthase B (EC 4.2.1.70) 
    CBSS-138119.3.peg.2719 tRNA pseudouridine synthase B (EC 4.2.1.70) 
  • PFAM:
    PseudoU_synth (CL0649) TruB_N; TruB family pseudouridylate synthase (N terminal domain) (PF01509; HMM-score: 183.2)
    TruB_C_2; tRNA pseudouridylate synthase B C-terminal domain (PF16198; HMM-score: 47)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    NWMN_1114(carB)carbamoyl phosphate synthase large subunit  [1] (data from MRSA252)
    NWMN_1587(citC)isocitrate dehydrogenase  [1] (data from MRSA252)
    NWMN_0932(folD)bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase  [1] (data from MRSA252)
    NWMN_1096(ftsZ)cell division protein FtsZ  [1] (data from MRSA252)
    NWMN_0509(fus)elongation factor G  [1] (data from MRSA252)
    NWMN_1756(hemL)glutamate-1-semialdehyde aminotransferase  [1] (data from MRSA252)
    NWMN_1348(ilvA)threonine dehydratase  [1] (data from MRSA252)
    NWMN_2004(murA)UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [1] (data from MRSA252)
    NWMN_2028(murZ)UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [1] (data from MRSA252)
    NWMN_2446(mvaS)3-hydroxy-3-methylglutaryl coenzyme A synthase  [1] (data from MRSA252)
    NWMN_0700(nrdE)ribonucleotide-diphosphate reductase subunit alpha  [1] (data from MRSA252)
    NWMN_0962(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    NWMN_2040(pdp)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    NWMN_0162(pflB)formate acetyltransferase  [1] (data from MRSA252)
    NWMN_0959(phdA)pyruvate dehydrogenase E1 component, alpha subunit  [1] (data from MRSA252)
    NWMN_1592(pykA)pyruvate kinase  [1] (data from MRSA252)
    NWMN_0500(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    NWMN_0502(rplL)50S ribosomal protein L7/L12  [1] (data from MRSA252)
    NWMN_2135(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    NWMN_0543(thiD)phosphomethylpyrimidine kinase  [1] (data from MRSA252)
    NWMN_0510(tufA)elongation factor Tu  [1] (data from MRSA252)
    NWMN_0355GTP-dependent nucleic acid-binding protein EngD  [1] (data from MRSA252)
    NWMN_0811hypothetical protein  [1] (data from MRSA252)
    NWMN_0839fumarylacetoacetate hydrolase family protein  [1] (data from MRSA252)
    NWMN_0881enoyl-(acyl carrier protein) reductase  [1] (data from MRSA252)
    NWMN_1604universal stress protein family protein  [1] (data from MRSA252)
    NWMN_2086alkaline shock protein 23  [1] (data from MRSA252)
    NWMN_2504malate:quinone oxidoreductase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.135
    • Ymax_pos: 39
    • Cmax: 0.131
    • Cmax_pos: 67
    • Smax: 0.206
    • Smax_pos: 34
    • Smean: 0.137
    • D: 0.136
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MYNGILPVYKERGLTSHDVVFKLRKILKTKKIGHTGTLDPEVAGVLPVCIGNATRVSDYVMDMGKAYEATVSIGRSTTTEDQTGDTLETKGVHSADFNKDDIDRLLESFKGIIEQIPPMYSSVKVNGKKLYEYARNNETVERPKRKVNIKDIGRISELDFKENECHFKIRVICGKGTYIRTLATDIGVKLGFPAHMSKLTRIESGGFVLKDSLTLEQIKELHEQDSLQNKLFPLEYGLKGLPSIKIKDSHIKKRILNGQKFNKNEFDNKIKDQIVFIDDDSEKVLAIYMVHPTKESEIKPKKVFN

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor: SigB [2] [3] other strains
    SigB (sigma factor) controls a large regulon involved in stress/starvation response and adaptation
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  2. Bettina Schulthess, Dominik A Bloes, Patrice François, Myriam Girard, Jacques Schrenzel, Markus Bischoff, Brigitte Berger-Bächi
    The σB-dependent yabJ-spoVG operon is involved in the regulation of extracellular nuclease, lipase, and protease expression in Staphylococcus aureus.
    J. Bacteriol.: 2011, 193(18);4954-62
    [PubMed:21725011] [WorldCat.org] [DOI] (I p)
  3. Markus Bischoff, Paul Dunman, Jan Kormanec, Daphne Macapagal, Ellen Murphy, William Mounts, Brigitte Berger-Bächi, Steven Projan
    Microarray-based analysis of the Staphylococcus aureus sigmaB regulon.
    J. Bacteriol.: 2004, 186(13);4085-99
    [PubMed:15205410] [WorldCat.org] [DOI] (P p)

Relevant publications[edit source | edit]