From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_2267 [new locus tag: NWMN_RS13050 ]
  • pan locus tag?: SAUPAN005877000
  • symbol: mqo
  • pan gene symbol?: mqo1
  • synonym:
  • product: malate:quinone oxidoreductase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_2267 [new locus tag: NWMN_RS13050 ]
  • symbol: mqo
  • product: malate:quinone oxidoreductase
  • replicon: chromosome
  • strand: -
  • coordinates: 2488988..2490523
  • length: 1536
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    ATGTCGTATTTCTCGAACGTTCCATTATTCATTTTAAAAAGGGGGACTGTATTTGTTATG
    ACAACACAACATAGCAAAACAGATGTCATCTTAATTGGTGGCGGTATTATGAGTGCAACA
    TTAGGAACATTACTTAAAGAATTATCACCTGAGAAAAATATTAAAGTGTTTGAAAAATTA
    GCACAACCTGGCGAAGAGAGTTCAAATGTATGGAATAATGCCGGTACAGGGCATTCAGCA
    CTTTGCGAGTTGAACTATACAAAAGAAGGTAAGGATGGCACAGTTGATTGTAGTAAAGCA
    ATTAAGATAAATGAGCAGTACCAAATTTCAAAACAGTTTTGGGCATATTTAGTTAAAACA
    GGACAATTAGATAACCCAGATCGCTTTATTCAAGCGGTGCCACACATGAGTTTTGTCATT
    GGCGAAGATAATGTAGCTTTTATAAAAAGTCGTGTTGCAACGTTAAAGAAAAGTATTTTA
    TTCGAAAAAATGAAATTATCGCAAGATGAAGAAGAAATGAAATCTTGGGTACCGTTAATG
    ATTGAAGGTCGTAAGTCTGATGAACCAATTGCTTTAACTTATGATGAAACTGGTACAGAT
    GTTAACTTTGGTGCGTTAACTGCAAAGTTATTTGATAATTTAGAGCAACGTGGTGTGGGA
    ATTCAATATAAGCAGAATGTATTAGACATCAAGAAACAGAAATCTGGGGTATGGCTAGTT
    AAAGTTAAAGATTTAGAAACTAATGAAACGACAACATATGAATCTGATTTTGTATTTATT
    GGTGCTGGCGGTGCGAGTTTACCATTACTCCAAAAGACTGGGATTAAACAATCAAAACAT
    ATTGGTGGTTTCCCGGTAAGTGGATTATTCCTGCGCTGTACAAATCAAGAAGTGATTGAT
    CGTCATCATGCTAAAGTGTACGGAAAAGCAGCAGTGGGTGCGCCACCAATGTCAGTGCCG
    CACTTAGATACACGTTTTGTAGACGGCAAGCGTTCATTGTTATTTGGTCCATTTGCAGGT
    TTCTCACCTAAATTTTTAAAAACAGGTTCACATATGGATTTAATTAAATCGGTTAAACCA
    AATAATATCGTGACGATGTTATCTGCAGGTATCAAAGAAATGAGTCTTACGAAGTATTTA
    GTGTCACAATTGATGTTATCTAATGATGAGCGTATGGATGATTTAAGAGTCTTTTTCCCA
    AATGCTAAAAATGAAGATTGGGAAGTGATTACAGCAGGGCAACGTGTCCAAGTAATCAAG
    GATACTGAGGATTCTAAAGGTAACTTACAATTTGGTACTGAAGTTATTACGTCAGATGAT
    GGCACATTAGCTGCATTACTTGGTGCATCACCTGGTGCGTCAACAGCTGTAGATATTATG
    TTTGATGTTTTACAGAGATGCTATCGTGATGAATTCAAAGGATGGGAACCAAAGATTAAA
    GAAATGGTGCCGTCATTTGGTTATCGCTTAACAGATCATGAGGATTTATATCATAAAATT
    AATGAAGAAGTAACTAAGTATTTACAAGTTAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1536

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_2267 [new locus tag: NWMN_RS13050 ]
  • symbol: Mqo
  • description: malate:quinone oxidoreductase
  • length: 511
  • theoretical pI: 7.06647
  • theoretical MW: 57014
  • GRAVY: -0.275538

Function[edit source | edit]

  • reaction:
    EC 1.1.5.4?  ExPASy
    Malate dehydrogenase (quinone)(S)-malate + a quinone = oxaloacetate + reduced quinone
  • TIGRFAM:
    MetabolismEnergy metabolismTCA cyclemalate dehydrogenase (acceptor) (TIGR01320; EC 1.1.5.4; HMM-score: 709.6)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 17.5)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersOtherC-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 16.2)
    Unknown functionEnzymes of unknown specificityflavoprotein, HI0933 family (TIGR00275; HMM-score: 15)
    MetabolismEnergy metabolismElectron transportthioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 12.3)
  • TheSEED:  
    CarbohydratesCentral carbohydrate metabolismTCA Cycle Malate:quinone oxidoreductase (EC 1.1.5.4) 
  • PFAM:
    NADP_Rossmann (CL0063) Mqo; Malate:quinone oxidoreductase (Mqo) (PF06039; HMM-score: 769.1)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 36.7)
    Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 16.9)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 16.1)
    FAD_binding_3; FAD binding domain (PF01494; HMM-score: 12.4)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors: FAD
  • effectors:
  • protein partners:
    NWMN_0372(ahpC)alkyl hydroperoxide reductase subunit C  [1] (data from MRSA252)
    NWMN_0745(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    NWMN_1625(fhs)formate--tetrahydrofolate ligase  [1] (data from MRSA252)
    NWMN_1096(ftsZ)cell division protein FtsZ  [1] (data from MRSA252)
    NWMN_0509(fus)elongation factor G  [1] (data from MRSA252)
    NWMN_0741(gapA)glyceraldehyde 3-phosphate dehydrogenase 1  [1] (data from MRSA252)
    NWMN_2056(glmS)glucosamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    NWMN_1217(glnA)glutamine synthetase  [1] (data from MRSA252)
    NWMN_0961(pdhC)branched-chain alpha-keto acid dehydrogenase subunit E2  [1] (data from MRSA252)
    NWMN_0962(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    NWMN_2040(pdp)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    NWMN_0162(pflB)formate acetyltransferase  [1] (data from MRSA252)
    NWMN_0742(pgk)phosphoglycerate kinase  [1] (data from MRSA252)
    NWMN_0959(phdA)pyruvate dehydrogenase E1 component, alpha subunit  [1] (data from MRSA252)
    NWMN_0960(phdB)pyruvate dehydrogenase E1 component, beta subunit  [1] (data from MRSA252)
    NWMN_1592(pykA)pyruvate kinase  [1] (data from MRSA252)
    NWMN_2140(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    NWMN_2137(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    NWMN_0014(rplI)50S ribosomal protein L9  [1] (data from MRSA252)
    NWMN_0501(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    NWMN_0499(rplK)50S ribosomal protein L11  [1] (data from MRSA252)
    NWMN_2125(rplQ)50S ribosomal protein L17  [1] (data from MRSA252)
    NWMN_1151(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    NWMN_1166(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    NWMN_2146(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    NWMN_1613(rpsD)30S ribosomal protein S4  [1] (data from MRSA252)
    NWMN_2138(rpsH)30S ribosomal protein S8  [1] (data from MRSA252)
    NWMN_2127(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    NWMN_2143(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    NWMN_1326(sucA)2-oxoglutarate dehydrogenase E1 component  [1] (data from MRSA252)
    NWMN_0743(tpiA)triosephosphate isomerase  [1] (data from MRSA252)
    NWMN_1057(trxA)thioredoxin  [1] (data from MRSA252)
    NWMN_1167(tsf)elongation factor Ts  [1] (data from MRSA252)
    NWMN_0510(tufA)elongation factor Tu  [1] (data from MRSA252)
    NWMN_0475cysteine synthase-like protein  [1] (data from MRSA252)
    NWMN_0641hypothetical protein  [1] (data from MRSA252)
    NWMN_1263aconitate hydratase  [1] (data from MRSA252)
    NWMN_1382DNA-binding protein HU  [1] (data from MRSA252)
    NWMN_1604universal stress protein family protein  [1] (data from MRSA252)
    NWMN_2086alkaline shock protein 23  [1] (data from MRSA252)
    NWMN_24541-pyrroline-5-carboxylate dehydrogenase  [1] (data from MRSA252)
    NWMN_2504malate:quinone oxidoreductase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cellwall
    • Cytoplasmic Score: 0.01
    • Cytoplasmic Membrane Score: 0.53
    • Cellwall Score: 8.75
    • Extracellular Score: 0.7
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.213
    • Ymax_pos: 14
    • Cmax: 0.146
    • Cmax_pos: 57
    • Smax: 0.497
    • Smax_pos: 4
    • Smean: 0.449
    • D: 0.305
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MSYFSNVPLFILKRGTVFVMTTQHSKTDVILIGGGIMSATLGTLLKELSPEKNIKVFEKLAQPGEESSNVWNNAGTGHSALCELNYTKEGKDGTVDCSKAIKINEQYQISKQFWAYLVKTGQLDNPDRFIQAVPHMSFVIGEDNVAFIKSRVATLKKSILFEKMKLSQDEEEMKSWVPLMIEGRKSDEPIALTYDETGTDVNFGALTAKLFDNLEQRGVGIQYKQNVLDIKKQKSGVWLVKVKDLETNETTTYESDFVFIGAGGASLPLLQKTGIKQSKHIGGFPVSGLFLRCTNQEVIDRHHAKVYGKAAVGAPPMSVPHLDTRFVDGKRSLLFGPFAGFSPKFLKTGSHMDLIKSVKPNNIVTMLSAGIKEMSLTKYLVSQLMLSNDERMDDLRVFFPNAKNEDWEVITAGQRVQVIKDTEDSKGNLQFGTEVITSDDGTLAALLGASPGASTAVDIMFDVLQRCYRDEFKGWEPKIKEMVPSFGYRLTDHEDLYHKINEEVTKYLQVK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]