From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS02155 [old locus tag: NWMN_0381 ]
  • pan locus tag?: SAUPAN001997000
  • symbol: NWMN_RS02155
  • pan gene symbol?: guaA
  • synonym:
  • product: GMP synthase (glutamine-hydrolyzing)

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS02155 [old locus tag: NWMN_0381 ]
  • symbol: NWMN_RS02155
  • product: GMP synthase (glutamine-hydrolyzing)
  • replicon: chromosome
  • strand: +
  • coordinates: 429442..430983
  • length: 1542
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (429442..430983) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    ATGGAAATGGCAAAAGAACAAGAGTTAATCCTTGTCTTAGACTTTGGTAGCCAATACAAC
    CAATTAATTACACGCCGAATTCGTGAAATGGGCGTTTATAGTGAATTACACGATCATGAA
    ATTTCAATTGAAGAAATTAAGAAAATGAATCCAAAAGGTATTATCTTATCAGGTGGTCCA
    AATTCAGTTTATGAAGAAGGTTCATTTACAATTGATCCGGAAATATATAATTTAGGAATT
    CCAGTACTTGGTATTTGTTACGGCATGCAATTAACTACTAAATTATTAGGTGGTAAAGTT
    GAACGTGCCAATGAACGTGAATACGGTAAAGCAATCATTAATGCGAAGTCAGATGAGTTA
    TTCGCTGGCTTACCAGCAGAACAAACTGTTTGGATGAGTCATTCTGATAAAGTTATTGAA
    ATTCCAGAAGGCTTTGAAGTTATCGCTGATAGCCCAAGCACAGACTATGCAGCAATCGAA
    GATAAGAAACGTCGCATTTATGGTGTTCAATTCCATCCAGAAGTACGTCATACAGAATAT
    GGTAATGATTTATTAAATAATTTTGTCCGTCGTGTTTGTGATTGTAGAGGTCAATGGACA
    ATGGAAAACTTTATCGAAATCGAAATTGAAAAGATTCGTCAACGCGTAGGAGACCGTCGT
    GTATTATGTGCGATGAGTGGCGGCGTAGATTCATCTGTTGTAGCTGTACTATTGCATAAA
    GCAATAGGTGATCAACTAACATGTATCTTTGTAGACCATGGCTTACTTCGTAAAGGTGAA
    GGCGACATGGTTATGGAGCAATTCGGTGAAGGTTTCAACATGAATATTATTCGTGTTAAT
    GCGAAAGATCGCTTTATGAATAAATTAAAAGGTGTTTCAGATCCTGAACAAAAACGTAAA
    ATCATTGGTAATGAATTTGTATACGTATTTGATGATGAAGCATCAAAACTGAAAGGTGTA
    GACTTCCTTGCGCAAGGAACACTATATACAGACGTCATCGAATCAGGTACTAAAACAGCA
    CAAACAATCAAATCACACCACAATGTTGGTGGATTACCAGAAGACATGGAATTCGAATTA
    ATCGAACCAATCAATACATTGTTTAAAGATGAAGTACGTAAATTAGGTATTGAGTTAGGT
    ATTCCAGAACATTTAGTATGGAGACAACCATTCCCAGGACCTGGTCTTGGTATTCGTGTA
    CTTGGAGAAATTACTGAAGATAAACTAGAAATCGTTAGAGAATCAGACGCGATTTTACGC
    CAAGTGATTAGAGAAGAAGGTCTTGAAAGAGAAATTTGGCAATACTTCACAGTGTTACCA
    AACATTCAATCAGTAGGTGTTATGGGAGACTACCGTACGTATGATCACACAGTAGGTATT
    CGTGCAGTAACATCTATCGACGGTATGACAAGTGACTTCGCACGCATCGATTGGGAAGTC
    TTACAAAAGATTTCTAGTCGTATCGTAAACGAAGTAGATCACGTCAACCGCGTAGTCTAT
    GACATTACATCAAAACCACCAAGCACAATTGAGTGGGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1542

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS02155 [old locus tag: NWMN_0381 ]
  • symbol: NWMN_RS02155
  • description: GMP synthase (glutamine-hydrolyzing)
  • length: 513
  • theoretical pI: 4.76247
  • theoretical MW: 58230
  • GRAVY: -0.289279

Function[edit source | edit]

  • reaction:
    EC 6.3.5.2?  ExPASy
    GMP synthase (glutamine-hydrolyzing)ATP + XMP + L-glutamine + H2O = AMP + diphosphate + GMP + L-glutamate
  • TIGRFAM:
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesPurine ribonucleotide biosynthesisGMP synthase (glutamine-hydrolyzing), C-terminal domain (TIGR00884; EC 6.3.5.2; HMM-score: 508)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesPurine ribonucleotide biosynthesisGMP synthase (glutamine-hydrolyzing), N-terminal domain (TIGR00888; EC 6.3.5.2; HMM-score: 274.7)
    glutamine amidotransferase of anthranilate synthase or aminodeoxychorismate synthase (TIGR00566; HMM-score: 65.1)
    MetabolismAmino acid biosynthesisAromatic amino acid familyanthranilate synthase (TIGR01815; EC 4.1.3.27; HMM-score: 56.2)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesPyrimidine ribonucleotide biosynthesiscarbamoyl-phosphate synthase, small subunit (TIGR01368; EC 6.3.5.5; HMM-score: 52.7)
    MetabolismAmino acid biosynthesisHistidine familyimidazole glycerol phosphate synthase, glutamine amidotransferase subunit (TIGR01855; EC 2.4.2.-; HMM-score: 35.8)
    MetabolismBiosynthesis of cofactors, prosthetic groups, and carriersPyridine nucleotidesNAD+ synthetase (TIGR00552; EC 6.3.1.5; HMM-score: 35.6)
    aminodeoxychorismate synthase (TIGR01823; EC 2.6.1.85; HMM-score: 32)
    Hypothetical proteinsConservedTIGR00268 family protein (TIGR00268; HMM-score: 24.3)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (TIGR00420; EC 2.1.1.61; HMM-score: 20.4)
    MetabolismAmino acid biosynthesisAspartate familyasparagine synthase (glutamine-hydrolyzing) (TIGR01536; EC 6.3.5.4; HMM-score: 17.6)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA(Ile)-lysidine synthetase (TIGR02432; EC 6.3.4.-; HMM-score: 17.6)
    asparagine synthase family amidotransferase (TIGR03104; HMM-score: 14.6)
    MetabolismPurines, pyrimidines, nucleosides, and nucleotidesPyrimidine ribonucleotide biosynthesisCTP synthase (TIGR00337; EC 6.3.4.2; HMM-score: 12.2)
  • TheSEED:
  • PFAM:
    Glutaminase_I (CL0014) GATase; Glutamine amidotransferase class-I (PF00117; HMM-score: 153.3)
    no clan definedGMP_synt_C; GMP synthase C terminal domain (PF00958; HMM-score: 144.7)
    Glutaminase_I (CL0014) Peptidase_C26; Peptidase C26 (PF07722; HMM-score: 40.6)
    HUP (CL0039) NAD_synthase; NAD synthase (PF02540; HMM-score: 36.7)
    tRNA_Me_trans; tRNA methyl transferase (PF03054; HMM-score: 24.4)
    Asn_synthase; Asparagine synthase (PF00733; HMM-score: 21.4)
    ATP_bind_3; PP-loop family (PF01171; HMM-score: 19.3)
    QueC; Queuosine biosynthesis protein QueC (PF06508; HMM-score: 17.5)
    no clan definedLEA_6; Late embryogenesis abundant protein 18 (PF10714; HMM-score: 17)
    HUP (CL0039) PAPS_reduct; Phosphoadenosine phosphosulfate reductase family (PF01507; HMM-score: 12.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    NWMN_RS0291550S ribosomal protein L1  [1] (data from MRSA252)
    NWMN_RS02960elongation factor G  [1] (data from MRSA252)
    NWMN_RS02965elongation factor Tu  [1] (data from MRSA252)
    NWMN_RS04195aldehyde dehydrogenase  [1] (data from MRSA252)
    NWMN_RS04590NADH dehydrogenase  [1] (data from MRSA252)
    NWMN_RS05380pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    NWMN_RS05385pyruvate dehydrogenase E1 component subunit beta  [1] (data from MRSA252)
    NWMN_RS05390dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex  [1] (data from MRSA252)
    NWMN_RS05395dihydrolipoyl dehydrogenase  [1] (data from MRSA252)
    NWMN_RS06210cell division protein FtsZ  [1] (data from MRSA252)
    NWMN_RS07455dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex  [1] (data from MRSA252)
    NWMN_RS0868550S ribosomal protein L21  [1] (data from MRSA252)
    NWMN_RS08905isocitrate dehydrogenase (NADP(+))  [1] (data from MRSA252)
    NWMN_RS08930pyruvate kinase  [1] (data from MRSA252)
    NWMN_RS11875glutamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    NWMN_RS1233050S ribosomal protein L15  [1] (data from MRSA252)
    NWMN_RS1239530S ribosomal protein S3  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.102
    • Ymax_pos: 37
    • Cmax: 0.108
    • Cmax_pos: 5
    • Smax: 0.136
    • Smax_pos: 28
    • Smean: 0.068
    • D: 0.089
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446347111 NCBI
  • RefSeq: WP_000424966 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MEMAKEQELILVLDFGSQYNQLITRRIREMGVYSELHDHEISIEEIKKMNPKGIILSGGPNSVYEEGSFTIDPEIYNLGIPVLGICYGMQLTTKLLGGKVERANEREYGKAIINAKSDELFAGLPAEQTVWMSHSDKVIEIPEGFEVIADSPSTDYAAIEDKKRRIYGVQFHPEVRHTEYGNDLLNNFVRRVCDCRGQWTMENFIEIEIEKIRQRVGDRRVLCAMSGGVDSSVVAVLLHKAIGDQLTCIFVDHGLLRKGEGDMVMEQFGEGFNMNIIRVNAKDRFMNKLKGVSDPEQKRKIIGNEFVYVFDDEASKLKGVDFLAQGTLYTDVIESGTKTAQTIKSHHNVGGLPEDMEFELIEPINTLFKDEVRKLGIELGIPEHLVWRQPFPGPGLGIRVLGEITEDKLEIVRESDAILRQVIREEGLEREIWQYFTVLPNIQSVGVMGDYRTYDHTVGIRAVTSIDGMTSDFARIDWEVLQKISSRIVNEVDHVNRVVYDITSKPPSTIEWE

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS02155 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]