From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS06585 [old locus tag: NWMN_1167 ]
  • pan locus tag?: SAUPAN003557000
  • symbol: NWMN_RS06585
  • pan gene symbol?: tsf
  • synonym:
  • product: elongation factor Ts

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS06585 [old locus tag: NWMN_1167 ]
  • symbol: NWMN_RS06585
  • product: elongation factor Ts
  • replicon: chromosome
  • strand: +
  • coordinates: 1281726..1282607
  • length: 882
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (1281726..1282607) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGGCAACTATTTCAGCAAAACTTGTTAAAGAATTACGTGAAAAAACTGGCGCGGGTATG
    ATGGATTGTAAAAAAGCGCTAACTGAAACTGATGGTGACATCGATAAAGCGATTGACTAC
    CTACGTGAAAAAGGTATTGCTAAAGCAGCTAAAAAAGCAGACCGTATTGCGGCTGAAGGT
    TTAGTACATGTAGAAACTAAAGGTAACGACGCAGTTATCGTTGAAATCAACTCTGAAACA
    GACTTTGTTGCTCGTAACGCAGGTTTCCAAGAGTTAGTTAAAGAAATCGCTAATCAAGTA
    TTAGATACAAAAGCTGAAACTGTTGAAGCTTTAATGGAAACAACTTTACCAAATGGTAAA
    TCAGTTGATGAAAGAATTAAAGAAGCAATTTCAACAATCGGTGAAAAATTAAGTGTTCGT
    CGTTTTGCTATCAGAACTAAAACTGATAACGATGCTTTCGGCGCTTACTTACACATGGGT
    GGACGCATTGGTGTATTAACAGTTGTTGAAGGTTCAACTGACGAAGAAGCAGCAAGAGAC
    GTTGCTATGCATATCGCTGCAATCAACCCTAAATATGTTTCTTCTGAACAAGTTAGCGAA
    GAAGAAATCAACCACGAAAGAGAAGTTTTAAAACAACAAGCATTAAATGAAGGTAAACCA
    GAAAACATCGTTGAAAAAATGGTGGAAGGACGTTTACGTAAATACTTACAAGAAATTTGT
    GCTGTAGATCAAGACTTCGTTAAAAACCCTGATGTAACAGTTGAAGCTTTCTTAAAAACA
    AAAGGTGGAAAACTTGTTGACTTCGTACGCTATGAAGTAGGCGAAGGTATGGAAAAACGC
    GAAGAAAACTTTGCGGATGAAGTTAAAGGACAAATGAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    882

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS06585 [old locus tag: NWMN_1167 ]
  • symbol: NWMN_RS06585
  • description: elongation factor Ts
  • length: 293
  • theoretical pI: 4.81593
  • theoretical MW: 32435.7
  • GRAVY: -0.458362

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Genetic information processingProtein synthesisTranslation factorstranslation elongation factor Ts (TIGR00116; HMM-score: 388.7)
  • TheSEED:
  • PFAM:
    no clan definedEF_TS; Elongation factor TS (PF00889; HMM-score: 252.6)
    Ku_C; Ku70/Ku80 C-terminal arm (PF03730; HMM-score: 17)
    UBA (CL0214) HOIP-UBA; HOIP UBA domain pair (PF16678; HMM-score: 16.9)
    no clan definedHBS1_N; HBS1 N-terminus (PF08938; HMM-score: 13.9)
    DUF3150; Protein of unknown function (DUF3150) (PF11348; HMM-score: 13)
    DUF2497; Protein of unknown function (DUF2497) (PF10691; HMM-score: 12.2)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    NWMN_RS11780(deoA)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    NWMN_RS00885formate acetyltransferase  [1] (data from MRSA252)
    NWMN_RS02965elongation factor Tu  [1] (data from MRSA252)
    NWMN_RS04590NADH dehydrogenase  [1] (data from MRSA252)
    NWMN_RS05380pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    NWMN_RS05385pyruvate dehydrogenase E1 component subunit beta  [1] (data from MRSA252)
    NWMN_RS05390dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex  [1] (data from MRSA252)
    NWMN_RS05395dihydrolipoyl dehydrogenase  [1] (data from MRSA252)
    NWMN_RS06210cell division protein FtsZ  [1] (data from MRSA252)
    NWMN_RS0649050S ribosomal protein L19  [1] (data from MRSA252)
    NWMN_RS0657530S ribosomal protein S2  [1] (data from MRSA252)
    NWMN_RS07455dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex  [1] (data from MRSA252)
    NWMN_RS07490undecaprenyldiphospho-muramoylpentapeptide beta-N- acetylglucosaminyltransferase  [1] (data from MRSA252)
    NWMN_RS07605serine/threonine dehydratase  [1] (data from MRSA252)
    NWMN_RS08350molecular chaperone DnaK  [1] (data from MRSA252)
    NWMN_RS0868550S ribosomal protein L21  [1] (data from MRSA252)
    NWMN_RS08905isocitrate dehydrogenase (NADP(+))  [1] (data from MRSA252)
    NWMN_RS09000acetate kinase  [1] (data from MRSA252)
    NWMN_RS12080Asp23/Gls24 family envelope stress response protein  [1] (data from MRSA252)
    NWMN_RS1230530S ribosomal protein S13  [1] (data from MRSA252)
    NWMN_RS1233050S ribosomal protein L15  [1] (data from MRSA252)
    NWMN_RS1234550S ribosomal protein L18  [1] (data from MRSA252)
    NWMN_RS1239530S ribosomal protein S3  [1] (data from MRSA252)
    NWMN_RS1240050S ribosomal protein L22  [1] (data from MRSA252)
    NWMN_RS1241050S ribosomal protein L2  [1] (data from MRSA252)
    NWMN_RS1242050S ribosomal protein L4  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.147
    • Ymax_pos: 13
    • Cmax: 0.141
    • Cmax_pos: 50
    • Smax: 0.274
    • Smax_pos: 1
    • Smean: 0.206
    • D: 0.17
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446123530 NCBI
  • RefSeq: WP_000201385 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MATISAKLVKELREKTGAGMMDCKKALTETDGDIDKAIDYLREKGIAKAAKKADRIAAEGLVHVETKGNDAVIVEINSETDFVARNAGFQELVKEIANQVLDTKAETVEALMETTLPNGKSVDERIKEAISTIGEKLSVRRFAIRTKTDNDAFGAYLHMGGRIGVLTVVEGSTDEEAARDVAMHIAAINPKYVSSEQVSEEEINHEREVLKQQALNEGKPENIVEKMVEGRLRKYLQEICAVDQDFVKNPDVTVEAFLKTKGGKLVDFVRYEVGEGMEKREENFADEVKGQMK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS06585 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]