From AureoWiki
Jump to: navigation, search
NCBI: 03-AUG-2016

Summary[edit source | edit]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_01058
  • pan locus tag?: SAUPAN003336000
  • symbol: SAOUHSC_01058
  • pan gene symbol?: typA
  • synonym:
  • product: GTP-binding protein TypA

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SAOUHSC_01058
  • symbol: SAOUHSC_01058
  • product: GTP-binding protein TypA
  • replicon: chromosome
  • strand: +
  • coordinates: 1023662..1025509
  • length: 1848
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    ATGACTAATAAAAGAGAAGATGTCCGCAATATAGCAATTATTGCTCACGTTGACCATGGT
    AAAACAACTTTAGTAGATGAGTTGTTAAAACAATCTGGTATATTCAGAGAAAATGAACAT
    GTCGATGAACGTGCAATGGACTCTAACGATATCGAAAGAGAGCGTGGAATTACGATTCTA
    GCCAAAAATACGGCTGTTGATTATAAAGGTACACGTATTAATATTTTGGATACACCAGGA
    CATGCAGACTTTGGTGGAGAAGTAGAACGTATTATGAAAATGGTTGATGGGGTTGTCTTA
    GTAGTAGATGCGTATGAAGGTACAATGCCTCAAACACGTTTTGTACTTAAAAAAGCGCTA
    GAACAAAACCTGAAACCTGTTGTTGTTGTTAATAAAATTGATAAACCATCAGCACGTCCA
    GAGGGTGTTGTAGATGAAGTTTTAGATTTATTTATTGAATTAGAAGCAAACGATGAACAA
    TTAGAATTCCCTGTTGTTTATGCTTCAGCAGTAAATGGTACAGCTAGCTTAGATCCTGAA
    AAGCAAGATGATAATTTACAATCATTATATGAAACAATTATTGATTATGTACCAGCTCCA
    ATTGATAACAGTGATGAGCCATTACAATTCCAAGTAGCATTGTTGGACTACAATGATTAT
    GTTGGACGTATTGGTATTGGTCGTGTATTCAGAGGTAAAATGCGTGTCGGAGATAATGTA
    TCACTAATTAAATTAGACGGTACAGTGAAAAACTTCCGTGTAACTAAAATCTTTGGTTAC
    TTTGGATTAAAACGTTTAGAAATTGAAGAAGCACAAGCTGGAGATTTAATTGCTGTTTCA
    GGTATGGAAGACATTAATGTTGGTGAAACTGTAACACCACATGACCATCAAGAAGCATTG
    CCAGTTCTACGTATTGATGAGCCTACTCTTGAAATGACATTTAAAGTTAACAATTCTCCA
    TTTGCTGGCCGTGAAGGTGACTTTGTAACAGCACGTCAAATTCAAGAACGTTTAAATCAA
    CAATTAGAAACAGATGTATCTTTGAAAGTTTCTAACACAGATTCTCCAGATACATGGGTA
    GTTGCTGGTCGCGGTGAATTGCATTTATCAATCCTTATTGAAAATATGCGTCGTGAAGGT
    TATGAATTACAAGTTTCAAAACCACAAGTAATTATTAAAGAAATAGATGGTGTAATGTGT
    GAACCATTTGAACGTGTGCAATGTGAAGTGCCACAAGAAAATGCAGGTGCTGTTATTGAA
    TCATTAGGTGCACGTAAAGGTGAAATGGTTGATATGACTACAACTGATAATGGACTTACA
    CGTTTAATCTTTAATGTACCGGCTCGTGGTATGATTGGTTATACGACTGAATTTATGTCA
    ATGACAAGAGGTTACGGTATTATTAACCATACATTTGAAGAATTTAGACCACGTATTAAA
    GCACAAATTGGCGGTCGTCGTAATGGTGCATTAATTTCAATGGATCAAGGTTCTGCAAGT
    ACTTATGCCATTTTGGGACTTGAAGATAGAGGTGTAAACTTCATGGAACCTGGTACTGAA
    GTTTATGAAGGTATGATTGTTGGTGAACATAATCGTGAAAATGATTTAACTGTTAACATC
    ACTAAAACAAAACATCAAACTAACGTACGTTCTGCAACGAAAGACCAAACACAAACAATG
    AATAGACCGCGTATTCTAACATTGGAAGAAGCGTTACAATTCATTAATGATGATGAACTT
    GTTGAGGTTACACCAGAAAGTATACGTTTAAGAAAGAAAATTTTAAACAAAAATGTTCGT
    GAAAAAGAAGCAAAGCGTATCAAACAAATGATGCAAGAAAACGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1848

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SAOUHSC_01058
  • symbol: SAOUHSC_01058
  • description: GTP-binding protein TypA
  • length: 615
  • theoretical pI: 4.66309
  • theoretical MW: 69195
  • GRAVY: -0.417724

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Cellular processesCellular processesAdaptations to atypical conditionsGTP-binding protein TypA/BipA (TIGR01394; HMM-score: 943.5)
    Genetic information processingProtein synthesisTranslation factorsGTP-binding protein TypA/BipA (TIGR01394; HMM-score: 943.5)
    Signal transductionRegulatory functionsOtherGTP-binding protein TypA/BipA (TIGR01394; HMM-score: 943.5)
    Genetic information processingProtein synthesisTranslation factorstranslation elongation factor G (TIGR00484; HMM-score: 220.7)
    Genetic information processingProtein synthesisTranslation factorstranslation elongation factor aEF-2 (TIGR00490; HMM-score: 211.9)
    Unknown functionGeneralelongation factor 4 (TIGR01393; EC 3.6.5.-; HMM-score: 209.7)
    Genetic information processingProtein synthesisTranslation factorstranslation elongation factor Tu (TIGR00485; HMM-score: 100.2)
    Genetic information processingProtein synthesisTranslation factorspeptide chain release factor 3 (TIGR00503; HMM-score: 92.9)
    Unknown functionGeneralsmall GTP-binding protein domain (TIGR00231; HMM-score: 85)
    Genetic information processingProtein synthesisTranslation factorsselenocysteine-specific translation elongation factor (TIGR00475; HMM-score: 75.6)
    Genetic information processingProtein synthesisTranslation factorstranslation initiation factor IF-2 (TIGR00487; HMM-score: 68)
    Genetic information processingProtein synthesisTranslation factorstranslation elongation factor EF-1, subunit alpha (TIGR00483; HMM-score: 67.8)
    MetabolismCentral intermediary metabolismSulfur metabolismsulfate adenylyltransferase, large subunit (TIGR02034; EC 2.7.7.4; HMM-score: 48.7)
    Genetic information processingProtein synthesisTranslation factorstranslation initiation factor aIF-2 (TIGR00491; HMM-score: 44.2)
    translation initiation factor 2, gamma subunit (TIGR03680; HMM-score: 35.7)
    Genetic information processingProtein synthesisOtherribosome-associated GTPase EngA (TIGR03594; HMM-score: 26.2)
    Genetic information processingProtein synthesistRNA and rRNA base modificationtRNA modification GTPase TrmE (TIGR00450; EC 3.6.-.-; HMM-score: 13.7)
    Genetic information processingProtein fateProtein modification and repair[FeFe] hydrogenase H-cluster maturation GTPase HydF (TIGR03918; HMM-score: 13.5)
    exopolysaccharide/PEP-CTERM locus tyrosine autokinase (TIGR03018; EC 2.7.10.2; HMM-score: 13.3)
    Genetic information processingProtein synthesisOtherribosome biogenesis GTP-binding protein YsxC (TIGR03598; HMM-score: 13)
    MetabolismTransport and binding proteinsCations and iron carrying compoundsferrous iron transport protein B (TIGR00437; HMM-score: 12.3)
  • TheSEED:  
    Protein MetabolismProtein biosynthesisUniversal GTPases GTP-binding protein TypA/BipA 
  • PFAM:
    P-loop_NTPase (CL0023) GTP_EFTU; Elongation factor Tu GTP binding domain (PF00009; HMM-score: 192.4)
    EF-G_C (CL0437) EFG_C; Elongation factor G C-terminus (PF00679; HMM-score: 78.6)
    EFTPs (CL0575) GTP_EFTU_D2; Elongation factor Tu domain 2 (PF03144; HMM-score: 41.2)
    P-loop_NTPase (CL0023) MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 31.6)
    EF-G_C (CL0437) EFG_II; Elongation Factor G, domain II (PF14492; HMM-score: 30.2)
    P-loop_NTPase (CL0023) FeoB_N; Ferrous iron transport protein B (PF02421; HMM-score: 20.3)
    Arf; ADP-ribosylation factor family (PF00025; HMM-score: 19.9)
    Septin; Septin (PF00735; HMM-score: 17.4)
    Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 13.6)
    SRPRB; Signal recognition particle receptor beta subunit (PF09439; HMM-score: 13.5)
    Ras; Ras family (PF00071; HMM-score: 12.2)

Structure, modifications & interactions[edit source | edit]

Localization[edit source | edit]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 1.05
    • Cytoplasmic Membrane Score: 8.78
    • Cellwall Score: 0.08
    • Extracellular Score: 0.09
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.113
    • Ymax_pos: 44
    • Cmax: 0.11
    • Cmax_pos: 42
    • Smax: 0.178
    • Smax_pos: 43
    • Smean: 0.099
    • D: 0.108
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MTNKREDVRNIAIIAHVDHGKTTLVDELLKQSGIFRENEHVDERAMDSNDIERERGITILAKNTAVDYKGTRINILDTPGHADFGGEVERIMKMVDGVVLVVDAYEGTMPQTRFVLKKALEQNLKPVVVVNKIDKPSARPEGVVDEVLDLFIELEANDEQLEFPVVYASAVNGTASLDPEKQDDNLQSLYETIIDYVPAPIDNSDEPLQFQVALLDYNDYVGRIGIGRVFRGKMRVGDNVSLIKLDGTVKNFRVTKIFGYFGLKRLEIEEAQAGDLIAVSGMEDINVGETVTPHDHQEALPVLRIDEPTLEMTFKVNNSPFAGREGDFVTARQIQERLNQQLETDVSLKVSNTDSPDTWVVAGRGELHLSILIENMRREGYELQVSKPQVIIKEIDGVMCEPFERVQCEVPQENAGAVIESLGARKGEMVDMTTTDNGLTRLIFNVPARGMIGYTTEFMSMTRGYGIINHTFEEFRPRIKAQIGGRRNGALISMDQGSASTYAILGLEDRGVNFMEPGTEVYEGMIVGEHNRENDLTVNITKTKHQTNVRSATKDQTQTMNRPRILTLEEALQFINDDELVEVTPESIRLRKKILNKNVREKEAKRIKQMMQENE

Experimental data[edit source | edit]

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 1.47 1.48

Relevant publications[edit source | edit]