From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS02005 [old locus tag: SA0351 ]
  • pan locus tag?: SAUPAN001909000
  • symbol: SA_RS02005
  • pan gene symbol?: ychF
  • synonym:
  • product: GTP-binding protein YchF

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA_RS02005 [old locus tag: SA0351 ]
  • symbol: SA_RS02005
  • product: GTP-binding protein YchF
  • replicon: chromosome
  • strand: +
  • coordinates: 410257..411354
  • length: 1098
  • essential: yes [1] DEG other strains

Accession numbers[edit | edit source]

  • Location: NC_002745 (410257..411354) NCBI
  • BioCyc: SA_RS02005 BioCyc
  • MicrobesOnline: see SA0351

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    ATGGCTTTAACAGCAGGTATCGTTGGCTTACCAAACGTTGGTAAATCAACATTATTTAAT
    GCAATTACAAAGGCGGGTGCCTTGGCAGCAAACTATCCGTTCGCAACTATAGACCCAAAT
    GTGGGTATTGTAGAAGTGCCAGATGCAAGACTACTTAAATTAGAAGAAATGGTTCAACCT
    AAAAAAACATTACCTACTACATTTGAATTTACAGATATTGCCGGAATTGTTAAAGGTGCT
    TCTAAAGGTGAAGGTTTAGGTAATAAATTCTTATCACATATTAGAGAAGTAGATGCAATT
    TGTCAGGTTGTTCGTGCTTTTGACGATGATAATGTAACACATGTAGCTGGTCGAGTTGAT
    CCAATTGATGACATCGAAGTTATCAATATGGAATTAGTACTTGCAGACTTAGAATCAGTT
    GAAAAACGCTTACCTAGAATTGAAAAATTGGCACGTCAAAAAGATAAGACTGCTGAAATG
    GAAGTGCGTATTTTAACAACTATTAAAGAAGCTTTAGAAAATGGTAAACCCGCTCGTAGT
    ATTGACTTTAATGAAGAAGACCAAAAATGGGTGAATCAAGCGCAATTACTGACTTCTAAA
    AAAATGCTTTATATCGCTAATGTTGGTGAAGATGAAATTGGTGATGATGATAATGATAAA
    GTAAAAGCGATTCGTGAATATGCAGCGCAAGAAGACTCTGAAGTGATTGTTATTAGTGCA
    AAAATTGAAGAAGAAATTGCTACATTAGATGATGAAGATAAAGAAATGTTCTTAGAAGAT
    TTAGGTATCGAAGAACCAGGATTAGATCGATTAATTAGAACAACTTATGAATTATTAGGA
    TTATCAACATATTTTACTGCTGGTGTGCAAGAAGTACGTGCTTGGACATTTAAACAAGGT
    ATGACTGCACCTCAATGTGCTGGTATCATTCATACTGATTTTGAACGTGGATTTATCCGT
    GCCGAAGTAACAAGTTATGATGACTATGTACAATATGGCGGCGAAAGTGGCGCTAAAGAA
    GCGGGCAGACAACGATTAGAAGGTAAAGAATATATTATGCAAGATGGCGATATCGTTCAT
    TTCAGATTTAATGTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1098

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA_RS02005 [old locus tag: SA0351 ]
  • symbol: SA_RS02005
  • description: GTP-binding protein YchF
  • length: 365
  • theoretical pI: 4.33991
  • theoretical MW: 40594.7
  • GRAVY: -0.288767

Function[edit | edit source]

  • TIGRFAM:
    Unknown function General GTP-binding protein YchF (TIGR00092; HMM-score: 516.4)
    and 11 more
    Genetic information processing Protein synthesis Other Obg family GTPase CgtA (TIGR02729; HMM-score: 80.9)
    Unknown function General GTP-binding protein HflX (TIGR03156; HMM-score: 37.8)
    Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 33.3)
    Genetic information processing Protein synthesis Other ribosome-associated GTPase EngA (TIGR03594; HMM-score: 30.9)
    Metabolism Transport and binding proteins Cations and iron carrying compounds ferrous iron transport protein B (TIGR00437; HMM-score: 27.9)
    Genetic information processing Protein synthesis Other ribosome biogenesis GTP-binding protein YlqF (TIGR03596; HMM-score: 24.4)
    Genetic information processing Protein synthesis Other GTP-binding protein Era (TIGR00436; HMM-score: 20.9)
    Genetic information processing Protein fate Protein modification and repair [FeFe] hydrogenase H-cluster maturation GTPase HydF (TIGR03918; HMM-score: 19.2)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA modification GTPase TrmE (TIGR00450; EC 3.6.-.-; HMM-score: 14.1)
    Genetic information processing Protein synthesis Other ribosome biogenesis GTP-binding protein YsxC (TIGR03598; HMM-score: 14.1)
    Genetic information processing Protein synthesis Other ribosome biogenesis GTPase YqeH (TIGR03597; HMM-score: 13.5)
  • TheSEED: see SA0351
  • PFAM:
    Ubiquitin (CL0072) YchF-GTPase_C; Protein of unknown function (DUF933) (PF06071; HMM-score: 136.6)
    and 3 more
    P-loop_NTPase (CL0023) MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 83.5)
    FeoB_N; Ferrous iron transport protein B (PF02421; HMM-score: 33.1)
    Ubiquitin (CL0072) TGS; TGS domain (PF02824; HMM-score: 15.5)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.140842
    • TAT(Tat/SPI): 0.037919
    • LIPO(Sec/SPII): 0.009151
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MALTAGIVGLPNVGKSTLFNAITKAGALAANYPFATIDPNVGIVEVPDARLLKLEEMVQPKKTLPTTFEFTDIAGIVKGASKGEGLGNKFLSHIREVDAICQVVRAFDDDNVTHVAGRVDPIDDIEVINMELVLADLESVEKRLPRIEKLARQKDKTAEMEVRILTTIKEALENGKPARSIDFNEEDQKWVNQAQLLTSKKMLYIANVGEDEIGDDDNDKVKAIREYAAQEDSEVIVISAKIEEEIATLDDEDKEMFLEDLGIEEPGLDRLIRTTYELLGLSTYFTAGVQEVRAWTFKQGMTAPQCAGIIHTDFERGFIRAEVTSYDDYVQYGGESGAKEAGRQRLEGKEYIMQDGDIVHFRFNV

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:
    SA_RS11130(deoA)pyrimidine-nucleoside phosphorylase  [2] (data from MRSA252)
    SA_RS09855(gatA)glutamyl-tRNA(Gln) amidotransferase subunit A  [2] (data from MRSA252)
    SA_RS00150DNA polymerase III subunit beta  [2] (data from MRSA252)
    SA_RS00185serine--tRNA ligase  [2] (data from MRSA252)
    SA_RS00310aminoglycoside O-nucleotidyltransferase ANT(4')-Ia  [2] (data from MRSA252)
    SA_RS00690immunoglobulin G-binding protein A  [2] (data from MRSA252)
    SA_RS01275formate acetyltransferase  [2] (data from MRSA252)
    SA_RS014452-C-methyl-D-erythritol 4-phosphate cytidylyltransferase  [2] (data from MRSA252)
    SA_RS017105'-nucleotidase, lipoprotein e(P4) family  [2] (data from MRSA252)
    SA_RS0202530S ribosomal protein S18  [2] (data from MRSA252)
    SA_RS02095alkyl hydroperoxide reductase subunit C  [2] (data from MRSA252)
    SA_RS02145IMP dehydrogenase  [2] (data from MRSA252)
    SA_RS02640ribose-phosphate pyrophosphokinase  [2] (data from MRSA252)
    SA_RS02695hypoxanthine-guanine phosphoribosyltransferase  [2] (data from MRSA252)
    SA_RS02710cysteine synthase  [2] (data from MRSA252)
    SA_RS02735lysine--tRNA ligase  [2] (data from MRSA252)
    SA_RS02810pyridoxal 5'-phosphate synthase lyase subunit PdxS  [2] (data from MRSA252)
    SA_RS0290550S ribosomal protein L11  [2] (data from MRSA252)
    SA_RS0291050S ribosomal protein L1  [2] (data from MRSA252)
    SA_RS0291550S ribosomal protein L10  [2] (data from MRSA252)
    SA_RS02955elongation factor G  [2] (data from MRSA252)
    SA_RS02960elongation factor Tu  [2] (data from MRSA252)
    SA_RS03115hydroxymethylpyrimidine/phosphomethylpyrimidine kinase  [2] (data from MRSA252)
    SA_RS03155phosphate acetyltransferase  [2] (data from MRSA252)
    SA_RS03380metal ABC transporter substrate-binding protein  [2] (data from MRSA252)
    SA_RS03645hypothetical protein  [2] (data from MRSA252)
    SA_RS04020ribosomal subunit interface protein  [2] (data from MRSA252)
    SA_RS04140aldehyde dehydrogenase  [2] (data from MRSA252)
    SA_RS04150triose-phosphate isomerase  [2] (data from MRSA252)
    SA_RS041552,3-bisphosphoglycerate-independent phosphoglycerate mutase  [2] (data from MRSA252)
    SA_RS04160enolase  [2] (data from MRSA252)
    SA_RS04325arsenate reductase  [2] (data from MRSA252)
    SA_RS04420ABC transporter ATP-binding protein  [2] (data from MRSA252)
    SA_RS04575NADH dehydrogenase  [2] (data from MRSA252)
    SA_RS04710hypothetical protein  [2] (data from MRSA252)
    SA_RS04915enoyl-ACP reductase  [2] (data from MRSA252)
    SA_RS05295phosphocarrier protein HPr  [2] (data from MRSA252)
    SA_RS05300phosphoenolpyruvate--protein phosphotransferase  [2] (data from MRSA252)
    SA_RS05355pyruvate dehydrogenase E1 component subunit beta  [2] (data from MRSA252)
    SA_RS05860cell division protein FtsZ  [2] (data from MRSA252)
    SA_RS06085beta-ketoacyl-ACP reductase  [2] (data from MRSA252)
    SA_RS0614050S ribosomal protein L19  [2] (data from MRSA252)
    SA_RS06165succinyl-CoA ligase subunit beta  [2] (data from MRSA252)
    SA_RS0622530S ribosomal protein S2  [2] (data from MRSA252)
    SA_RS0631530S ribosomal protein S15  [2] (data from MRSA252)
    SA_RS06490glutamine synthetase  [2] (data from MRSA252)
    SA_RS06690transketolase  [2] (data from MRSA252)
    SA_RS07060dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex  [2] (data from MRSA252)
    SA_RS07205serine/threonine dehydratase  [2] (data from MRSA252)
    SA_RS07385DNA-binding protein HU  [2] (data from MRSA252)
    SA_RS0828550S ribosomal protein L27  [2] (data from MRSA252)
    SA_RS08435trigger factor  [2] (data from MRSA252)
    SA_RS08505aldehyde dehydrogenase  [2] (data from MRSA252)
    SA_RS08545isocitrate dehydrogenase (NADP(+))  [2] (data from MRSA252)
    SA_RS08560pyruvate kinase  [2] (data from MRSA252)
    SA_RS08600universal stress protein  [2] (data from MRSA252)
    SA_RS08625universal stress protein UspA  [2] (data from MRSA252)
    SA_RS08630acetate kinase  [2] (data from MRSA252)
    SA_RS09810non-heme ferritin  [2] (data from MRSA252)
    SA_RS09850aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B  [2] (data from MRSA252)
    SA_RS10855D-alanine--D-alanine ligase  [2] (data from MRSA252)
    SA_RS10945UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [2] (data from MRSA252)
    SA_RS11010uracil phosphoribosyltransferase  [2] (data from MRSA252)
    SA_RS11070UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [2] (data from MRSA252)
    SA_RS11430Asp23/Gls24 family envelope stress response protein  [2] (data from MRSA252)
    SA_RS1160030S ribosomal protein S9  [2] (data from MRSA252)
    SA_RS1160550S ribosomal protein L13  [2] (data from MRSA252)
    SA_RS1164030S ribosomal protein S11  [2] (data from MRSA252)
    SA_RS1164530S ribosomal protein S13  [2] (data from MRSA252)
    SA_RS1167550S ribosomal protein L30  [2] (data from MRSA252)
    SA_RS1168030S ribosomal protein S5  [2] (data from MRSA252)
    SA_RS1169050S ribosomal protein L6  [2] (data from MRSA252)
    SA_RS1169530S ribosomal protein S8  [2] (data from MRSA252)
    SA_RS1170550S ribosomal protein L5  [2] (data from MRSA252)
    SA_RS1173530S ribosomal protein S3  [2] (data from MRSA252)
    SA_RS1174050S ribosomal protein L22  [2] (data from MRSA252)
    SA_RS1174530S ribosomal protein S19  [2] (data from MRSA252)
    SA_RS1175050S ribosomal protein L2  [2] (data from MRSA252)
    SA_RS1175550S ribosomal protein L23  [2] (data from MRSA252)
    SA_RS1176050S ribosomal protein L4  [2] (data from MRSA252)
    SA_RS1177030S ribosomal protein S10  [2] (data from MRSA252)
    SA_RS13340pyruvate oxidase  [2] (data from MRSA252)
    SA_RS13375hydroxymethylglutaryl-CoA synthase  [2] (data from MRSA252)
    SA_RS13420L-glutamate gamma-semialdehyde dehydrogenase  [2] (data from MRSA252)
    SA_RS13730class I fructose-bisphosphate aldolase  [2] (data from MRSA252)
    SA_RS13735malate:quinone oxidoreductase  [2] (data from MRSA252)
    SA_RS13920arginine deiminase  [2] (data from MRSA252)

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. R Allyn Forsyth, Robert J Haselbeck, Kari L Ohlsen, Robert T Yamamoto, Howard Xu, John D Trawick, Daniel Wall, Liangsu Wang, Vickie Brown-Driver, Jamie M Froelich, Kedar G C, Paula King, Melissa McCarthy, Cheryl Malone, Brian Misiner, David Robbins, Zehui Tan, Zhan-yang Zhu Zy, Grant Carr, Deborah A Mosca, Carlos Zamudio, J Gordon Foulkes, Judith W Zyskind
    A genome-wide strategy for the identification of essential genes in Staphylococcus aureus.
    Mol Microbiol: 2002, 43(6);1387-400
    [PubMed:11952893] [WorldCat.org] [DOI] (P p)
  2. 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 2.19 2.20 2.21 2.22 2.23 2.24 2.25 2.26 2.27 2.28 2.29 2.30 2.31 2.32 2.33 2.34 2.35 2.36 2.37 2.38 2.39 2.40 2.41 2.42 2.43 2.44 2.45 2.46 2.47 2.48 2.49 2.50 2.51 2.52 2.53 2.54 2.55 2.56 2.57 2.58 2.59 2.60 2.61 2.62 2.63 2.64 2.65 2.66 2.67 2.68 2.69 2.70 2.71 2.72 2.73 2.74 2.75 2.76 2.77 2.78 2.79 2.80 2.81 2.82 2.83 2.84 2.85 2.86 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]