Due to technical reasons this service will not be available for 7 days from 27 Nov to 04 Dec 2017
From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS06995 [old locus tag: SA1232 ]
  • pan locus tag?: SAUPAN003813000
  • symbol: SA_RS06995
  • pan gene symbol?: lysA
  • synonym:
  • product: diaminopimelate decarboxylase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA_RS06995 [old locus tag: SA1232 ]
  • symbol: SA_RS06995
  • product: diaminopimelate decarboxylase
  • replicon: chromosome
  • strand: +
  • coordinates: 1406729..1407994
  • length: 1266
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_002745 (1406729..1407994) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    ATGACTGTTAAATATAATCAAAATGGCGAATTAACAATGGATGGTATTAGTTTAAAAACG
    ATTGCACAAAGCTTTGGTACACCTACCATTGTTTATGATGAACTACAAATTAGAGAACAG
    ATGCGCCGTTACCATCGCGCATTTAAAGATAGTGGATTAAAATACAATATTTCATACGCC
    TCAAAGGCATTTACTTGCATTCAAATGGTCAAACTTGTAGCTGAGGAAGATTTACAGTTA
    GATGTTGTTTCTGAAGGTGAATTATATACAGCTTTAGAAGCAGGTTTTGAACCGAGTCGC
    ATCCATTTCCATGGTAACAATAAAACGAAACATGAAATTAGGTATGCTTTAGAAAATAAT
    ATCGGTTATTTTGTTATAGATTCATTAGAAGAAATTGAATTAATAGACCGCTATGCTAAT
    GATACGGTTCAAGTTGTATTACGAGTTAATCCAGGTGTTGAAGCACATACACACGAATTT
    ATTCAAACTGGGCAAGAAGATAGTAAGTTTGGATTATCAATTCAATATGGCTTAGCTAAA
    AAAGCAATTGACAAAGTCCAACAATCTAAACACTTAAAATTAAAAGGTGTACATTGTCAT
    ATTGGTTCACAGATTGAAGGTACAGAAGCATTTATTGAAACTGCTAAAATTGTTTTACGT
    TGGCTTAAAGAGCAAGGCATTCAAGTTGAATTATTAAACCTTGGTGGTGGCTTTGGTATT
    AAATATGTTGAAGGTGACGAAAGTTTCCCTATCGAAAGTGGTATTAAAGATATTACAGAC
    GCAATAAAATCCGAAATTAAAGTTCTAGGTATAGATGCACCAGAAATAGGTATTGAACCG
    GGACGATCAATTGTAGGTGAAGCTGGCGTTACTTTATATGAAGTTGGAACCATTAAAGAA
    ATTCCAGAGATTAATAAATATGTTTCAATCGATGGCGGTATGAGTGATCATATCAGAACT
    GCACTTTATGACGCAAAGTATCAAGCATTGCTTGTTAATAGAAATGAAGAAGCAGATGAC
    AGTGTAACTATAGCTGGAAAATTATGTGAGTCTGGTGATATCATTATTAAAGACGCTAAA
    TTACCTTCATCAGTCAAACGTGGAGACTATCTTGCTATATTATCAACTGGTGCATATCAT
    TACTCTATGGCATCCAATTACAATCAAATGCAAAAGCCTTCTGTGTTTTTCTTAAAAGAT
    GGCAAAGCACGTGAAGTTATAAAGCGACAATCGTTAAGACAACTCATTATTAATGATACA
    AAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1266

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA_RS06995 [old locus tag: SA1232 ]
  • symbol: SA_RS06995
  • description: diaminopimelate decarboxylase
  • length: 421
  • theoretical pI: 5.65794
  • theoretical MW: 47034.2
  • GRAVY: -0.284086

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismAmino acid biosynthesisAspartate familydiaminopimelate decarboxylase (TIGR01048; EC 4.1.1.20; HMM-score: 461.8)
    pyridoxal-dependent decarboxylase, exosortase A system-associated (TIGR03099; HMM-score: 183.8)
    MetabolismCentral intermediary metabolismPolyamine biosynthesisarginine decarboxylase (TIGR01273; EC 4.1.1.19; HMM-score: 57.8)
    MetabolismCentral intermediary metabolismPolyamine biosynthesiscarboxynorspermidine decarboxylase (TIGR01047; HMM-score: 38)
    Unknown functionEnzymes of unknown specificitypyridoxal phosphate enzyme, YggS family (TIGR00044; HMM-score: 12.7)
  • TheSEED:
  • PFAM:
    TIM_barrel (CL0036) Orn_Arg_deC_N; Pyridoxal-dependent decarboxylase, pyridoxal binding domain (PF02784; HMM-score: 226)
    no clan definedOrn_DAP_Arg_deC; Pyridoxal-dependent decarboxylase, C-terminal sheet domain (PF00278; HMM-score: 67.3)
    TIM_barrel (CL0036) Ala_racemase_N; Alanine racemase, N-terminal domain (PF01168; HMM-score: 21)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA_RS09855(gatA)glutamyl-tRNA(Gln) amidotransferase subunit A  [1] (data from MRSA252)
    SA_RS00150DNA polymerase III subunit beta  [1] (data from MRSA252)
    SA_RS00310aminoglycoside O-nucleotidyltransferase ANT(4')-Ia  [1] (data from MRSA252)
    SA_RS01275formate acetyltransferase  [1] (data from MRSA252)
    SA_RS01365L-lactate dehydrogenase  [1] (data from MRSA252)
    SA_RS02005GTP-binding protein YchF  [1] (data from MRSA252)
    SA_RS0265050S ribosomal protein L25/general stress protein Ctc  [1] (data from MRSA252)
    SA_RS02710cysteine synthase  [1] (data from MRSA252)
    SA_RS0291550S ribosomal protein L10  [1] (data from MRSA252)
    SA_RS0292050S ribosomal protein L7/L12  [1] (data from MRSA252)
    SA_RS02960elongation factor Tu  [1] (data from MRSA252)
    SA_RS04140aldehyde dehydrogenase  [1] (data from MRSA252)
    SA_RS04575NADH dehydrogenase  [1] (data from MRSA252)
    SA_RS04680glucose-6-phosphate isomerase  [1] (data from MRSA252)
    SA_RS04785beta-ketoacyl-[acyl-carrier-protein] synthase II  [1] (data from MRSA252)
    SA_RS05295phosphocarrier protein HPr  [1] (data from MRSA252)
    SA_RS05350pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SA_RS05355pyruvate dehydrogenase E1 component subunit beta  [1] (data from MRSA252)
    SA_RS05360dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex  [1] (data from MRSA252)
    SA_RS05365dihydrolipoyl dehydrogenase  [1] (data from MRSA252)
    SA_RS0614050S ribosomal protein L19  [1] (data from MRSA252)
    SA_RS0622530S ribosomal protein S2  [1] (data from MRSA252)
    SA_RS07605phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)  [1] (data from MRSA252)
    SA_RS07955molecular chaperone DnaK  [1] (data from MRSA252)
    SA_RS08505aldehyde dehydrogenase  [1] (data from MRSA252)
    SA_RS08560pyruvate kinase  [1] (data from MRSA252)
    SA_RS08565ATP-dependent 6-phosphofructokinase  [1] (data from MRSA252)
    SA_RS08625universal stress protein UspA  [1] (data from MRSA252)
    SA_RS09850aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B  [1] (data from MRSA252)
    SA_RS10535molecular chaperone GroEL  [1] (data from MRSA252)
    SA_RS11010uracil phosphoribosyltransferase  [1] (data from MRSA252)
    SA_RS11245glutamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    SA_RS11430Asp23/Gls24 family envelope stress response protein  [1] (data from MRSA252)
    SA_RS1163050S ribosomal protein L17  [1] (data from MRSA252)
    SA_RS1167050S ribosomal protein L15  [1] (data from MRSA252)
    SA_RS1167550S ribosomal protein L30  [1] (data from MRSA252)
    SA_RS1168030S ribosomal protein S5  [1] (data from MRSA252)
    SA_RS1170550S ribosomal protein L5  [1] (data from MRSA252)
    SA_RS1173530S ribosomal protein S3  [1] (data from MRSA252)
    SA_RS1174050S ribosomal protein L22  [1] (data from MRSA252)
    SA_RS1175550S ribosomal protein L23  [1] (data from MRSA252)
    SA_RS1177030S ribosomal protein S10  [1] (data from MRSA252)
    SA_RS126452,3-bisphosphoglycerate-dependent phosphoglycerate mutase  [1] (data from MRSA252)
    SA_RS13375hydroxymethylglutaryl-CoA synthase  [1] (data from MRSA252)
    SA_RS13730class I fructose-bisphosphate aldolase  [1] (data from MRSA252)
    SA_RS13735malate:quinone oxidoreductase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.138
    • Ymax_pos: 25
    • Cmax: 0.135
    • Cmax_pos: 25
    • Smax: 0.193
    • Smax_pos: 5
    • Smean: 0.144
    • D: 0.14
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 446139091 NCBI
  • RefSeq: WP_000216946 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MTVKYNQNGELTMDGISLKTIAQSFGTPTIVYDELQIREQMRRYHRAFKDSGLKYNISYASKAFTCIQMVKLVAEEDLQLDVVSEGELYTALEAGFEPSRIHFHGNNKTKHEIRYALENNIGYFVIDSLEEIELIDRYANDTVQVVLRVNPGVEAHTHEFIQTGQEDSKFGLSIQYGLAKKAIDKVQQSKHLKLKGVHCHIGSQIEGTEAFIETAKIVLRWLKEQGIQVELLNLGGGFGIKYVEGDESFPIESGIKDITDAIKSEIKVLGIDAPEIGIEPGRSIVGEAGVTLYEVGTIKEIPEINKYVSIDGGMSDHIRTALYDAKYQALLVNRNEEADDSVTIAGKLCESGDIIIKDAKLPSSVKRGDYLAILSTGAYHYSMASNYNQMQKPSVFFLKDGKAREVIKRQSLRQLIINDTK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • SA_RS06995 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]