From AureoWiki
Jump to: navigation, search
NCBI: 26-AUG-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus N315
  • locus tag: SA1232 [new locus tag: SA_RS06995 ]
  • pan locus tag?: SAUPAN003813000
  • symbol: lysA
  • pan gene symbol?: lysA
  • synonym:
  • product: diaminopimelate decarboxylase

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: SA1232 [new locus tag: SA_RS06995 ]
  • symbol: lysA
  • product: diaminopimelate decarboxylase
  • replicon: chromosome
  • strand: +
  • coordinates: 1406729..1407994
  • length: 1266
  • essential: no DEG other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    ATGACTGTTAAATATAATCAAAATGGCGAATTAACAATGGATGGTATTAGTTTAAAAACG
    ATTGCACAAAGCTTTGGTACACCTACCATTGTTTATGATGAACTACAAATTAGAGAACAG
    ATGCGCCGTTACCATCGCGCATTTAAAGATAGTGGATTAAAATACAATATTTCATACGCC
    TCAAAGGCATTTACTTGCATTCAAATGGTCAAACTTGTAGCTGAGGAAGATTTACAGTTA
    GATGTTGTTTCTGAAGGTGAATTATATACAGCTTTAGAAGCAGGTTTTGAACCGAGTCGC
    ATCCATTTCCATGGTAACAATAAAACGAAACATGAAATTAGGTATGCTTTAGAAAATAAT
    ATCGGTTATTTTGTTATAGATTCATTAGAAGAAATTGAATTAATAGACCGCTATGCTAAT
    GATACGGTTCAAGTTGTATTACGAGTTAATCCAGGTGTTGAAGCACATACACACGAATTT
    ATTCAAACTGGGCAAGAAGATAGTAAGTTTGGATTATCAATTCAATATGGCTTAGCTAAA
    AAAGCAATTGACAAAGTCCAACAATCTAAACACTTAAAATTAAAAGGTGTACATTGTCAT
    ATTGGTTCACAGATTGAAGGTACAGAAGCATTTATTGAAACTGCTAAAATTGTTTTACGT
    TGGCTTAAAGAGCAAGGCATTCAAGTTGAATTATTAAACCTTGGTGGTGGCTTTGGTATT
    AAATATGTTGAAGGTGACGAAAGTTTCCCTATCGAAAGTGGTATTAAAGATATTACAGAC
    GCAATAAAATCCGAAATTAAAGTTCTAGGTATAGATGCACCAGAAATAGGTATTGAACCG
    GGACGATCAATTGTAGGTGAAGCTGGCGTTACTTTATATGAAGTTGGAACCATTAAAGAA
    ATTCCAGAGATTAATAAATATGTTTCAATCGATGGCGGTATGAGTGATCATATCAGAACT
    GCACTTTATGACGCAAAGTATCAAGCATTGCTTGTTAATAGAAATGAAGAAGCAGATGAC
    AGTGTAACTATAGCTGGAAAATTATGTGAGTCTGGTGATATCATTATTAAAGACGCTAAA
    TTACCTTCATCAGTCAAACGTGGAGACTATCTTGCTATATTATCAACTGGTGCATATCAT
    TACTCTATGGCATCCAATTACAATCAAATGCAAAAGCCTTCTGTGTTTTTCTTAAAAGAT
    GGCAAAGCACGTGAAGTTATAAAGCGACAATCGTTAAGACAACTCATTATTAATGATACA
    AAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1266

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: SA1232 [new locus tag: SA_RS06995 ]
  • symbol: LysA
  • description: diaminopimelate decarboxylase
  • length: 421
  • theoretical pI: 5.65794
  • theoretical MW: 47034.2
  • GRAVY: -0.284086

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    MetabolismAmino acid biosynthesisAspartate familydiaminopimelate decarboxylase (TIGR01048; EC 4.1.1.20; HMM-score: 461.8)
    pyridoxal-dependent decarboxylase, exosortase A system-associated (TIGR03099; HMM-score: 183.8)
    MetabolismCentral intermediary metabolismPolyamine biosynthesisarginine decarboxylase (TIGR01273; EC 4.1.1.19; HMM-score: 57.8)
    MetabolismCentral intermediary metabolismPolyamine biosynthesiscarboxynorspermidine decarboxylase (TIGR01047; HMM-score: 38)
    Unknown functionEnzymes of unknown specificitypyridoxal phosphate enzyme, YggS family (TIGR00044; HMM-score: 12.7)
  • TheSEED:  
    Amino Acids and DerivativesLysine, threonine, methionine, and cysteineLysine Biosynthesis DAP Pathway Diaminopimelate decarboxylase (EC 4.1.1.20) 
  • PFAM:
    TIM_barrel (CL0036) Orn_Arg_deC_N; Pyridoxal-dependent decarboxylase, pyridoxal binding domain (PF02784; HMM-score: 226)
    no clan definedOrn_DAP_Arg_deC; Pyridoxal-dependent decarboxylase, C-terminal sheet domain (PF00278; HMM-score: 67.3)
    TIM_barrel (CL0036) Ala_racemase_N; Alanine racemase, N-terminal domain (PF01168; HMM-score: 21)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    SA0033(aadD)kanamycin nucleotidyltransferase  [1] (data from MRSA252)
    SA1984(asp23)alkaline shock protein 23  [1] (data from MRSA252)
    SA0471(cysK)hypothetical protein  [1] (data from MRSA252)
    SA1409(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    SA0002(dnaN)DNA polymerase III subunit beta  [1] (data from MRSA252)
    SA0843(fab)3-oxoacyl-ACP synthase  [1] (data from MRSA252)
    SA0727(gap)glyceraldehyde-3-phosphate dehydrogenase  [1] (data from MRSA252)
    SA1510(gapB)glyceraldehyde 3-phosphate dehydrogenase 2  [1] (data from MRSA252)
    SA1716(gatA)aspartyl/glutamyl-tRNA amidotransferase subunit A  [1] (data from MRSA252)
    SA1715(gatB)aspartyl/glutamyl-tRNA amidotransferase subunit B  [1] (data from MRSA252)
    SA1959(glmS)glucosamine--fructose-6-phosphate aminotransferase  [1] (data from MRSA252)
    SA1342(gnd)6-phosphogluconate dehydrogenase  [1] (data from MRSA252)
    SA2204(gpmA)phosphoglyceromutase  [1] (data from MRSA252)
    SA1836(groEL)molecular chaperone GroEL  [1] (data from MRSA252)
    SA0232(lctE)L-lactate dehydrogenase  [1] (data from MRSA252)
    SA2400(mqo2)malate:quinone oxidoreductase  [1] (data from MRSA252)
    SA2334(mvaS)3-hydroxy-3-methylglutaryl-CoA synthase  [1] (data from MRSA252)
    SA0943-1(pdhA)pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    SA0944(pdhB)pyruvate dehydrogenase E1 component subunit beta  [1] (data from MRSA252)
    SA0945(pdhC)branched-chain alpha-keto acid dehydrogenase E2 subunit  [1] (data from MRSA252)
    SA0946(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    SA1521(pfkA)6-phosphofructokinase  [1] (data from MRSA252)
    SA0218(pflB)formate acetyltransferase  [1] (data from MRSA252)
    SA0823(pgi)glucose-6-phosphate isomerase  [1] (data from MRSA252)
    SA0934(ptsH)phosphocarrier protein HPr  [1] (data from MRSA252)
    SA1520(pykA)pyruvate kinase  [1] (data from MRSA252)
    SA2035(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    SA0497(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    SA0498(rplL)50S ribosomal protein L7/L12  [1] (data from MRSA252)
    SA2029(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    SA2022(rplQ)50S ribosomal protein L17  [1] (data from MRSA252)
    SA1084(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    SA2042(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    SA2045(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    SA0459(rplY)50S ribosomal protein L25  [1] (data from MRSA252)
    SA2030(rpmD)50S ribosomal protein L30  [1] (data from MRSA252)
    SA1099(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    SA2041(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    SA2031(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    SA2048(rpsJ)30S ribosomal protein S10  [1] (data from MRSA252)
    SA0506(tuf)elongation factor Tu  [1] (data from MRSA252)
    SA1914(upp)uracil phosphoribosyltransferase  [1] (data from MRSA252)
    SA0351GTP-dependent nucleic acid-binding protein EngD  [1] (data from MRSA252)
    SA0802hypothetical protein  [1] (data from MRSA252)
    SA1532hypothetical protein  [1] (data from MRSA252)
    SA2399fructose-1,6-bisphosphate aldolase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.138
    • Ymax_pos: 25
    • Cmax: 0.135
    • Cmax_pos: 25
    • Smax: 0.193
    • Smax_pos: 5
    • Smean: 0.144
    • D: 0.14
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 15926980 NCBI
  • RefSeq: NP_374513 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MTVKYNQNGELTMDGISLKTIAQSFGTPTIVYDELQIREQMRRYHRAFKDSGLKYNISYASKAFTCIQMVKLVAEEDLQLDVVSEGELYTALEAGFEPSRIHFHGNNKTKHEIRYALENNIGYFVIDSLEEIELIDRYANDTVQVVLRVNPGVEAHTHEFIQTGQEDSKFGLSIQYGLAKKAIDKVQQSKHLKLKGVHCHIGSQIEGTEAFIETAKIVLRWLKEQGIQVELLNLGGGFGIKYVEGDESFPIESGIKDITDAIKSEIKVLGIDAPEIGIEPGRSIVGEAGVTLYEVGTIKEIPEINKYVSIDGGMSDHIRTALYDAKYQALLVNRNEEADDSVTIAGKLCESGDIIIKDAKLPSSVKRGDYLAILSTGAYHYSMASNYNQMQKPSVFFLKDGKAREVIKRQSLRQLIINDTK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulators: Lysine, CodY
    Lysine (RNA) important in Lysine biosynthesis  RegPrecise
    CodY (TF) important in Amino acid metabolism  RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45

Relevant publications[edit source | edit]