NCBI: 03-AUG-2016
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus NCTC8325
- locus tag: SAOUHSC_00715
- pan locus tag?: SAUPAN002591000
- symbol: SAOUHSC_00715
- pan gene symbol?: saeR
- synonym:
- product: response regulator
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAOUHSC_00715
- symbol: SAOUHSC_00715
- product: response regulator
- replicon: chromosome
- strand: -
- coordinates: 700249..700935
- length: 687
- essential: no DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3919342 NCBI
- RefSeq: YP_499274 NCBI
- BioCyc: G1I0R-668 BioCyc
- MicrobesOnline: 1289184 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661ATGACCCACTTACTGATCGTGGATGATGAACAAGACATTGTAGACATTTGTCAAACCTAT
TTTGAATATGAAGGTTACAAAGTAACAACGACAACTAGCGGTAAAGAAGCAATTTCTTTA
CTATCAAATGATATTGATATCATGGTACTTGATATCATGATGCCAGAAGTTAATGGTTAC
GACATTGTCAAAGAAATGAAAAGGCAAAAATTAGATATCCCCTTTATCTATTTAACTGCC
AAAACACAAGAACATGATACCATTTACGCCTTAACTTTAGGTGCAGATGACTATGTCAAA
AAACCATTTAGTCCAAGGGAACTCGTTTTACGTATTAATAATTTACTTACAAGAATGAAG
AAATACCATCATCAACCAGTTGAACAACTGTCGTTTGATGAATTAACACTTATTAACTTA
AGTAAAGTTGTGACTGTAAATGGTCACGAAGTCCCTATGCGTATTAAGGAATTTGAGTTA
TTGTGGTATTTAGCTTCTAGAGAAAATGAAGTTATTTCTAAATCAGAATTACTTGAAAAA
GTTTGGGGATATGACTATTACGAAGATGCTAATACCGTGAATGTCCATATACACCGTATT
AGAGAAAAATTAGAAAAAGAGAGCTTTACAACATATACCATCACAACTGTATGGGGATTA
GGATATAAATTTGAAAGGAGCCGATAA60
120
180
240
300
360
420
480
540
600
660
687
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAOUHSC_00715
- symbol: SAOUHSC_00715
- description: response regulator
- length: 228
- theoretical pI: 5.0506
- theoretical MW: 26857.6
- GRAVY: -0.339912
⊟Function[edit | edit source]
- TIGRFAM: Regulatory functions DNA interactions phosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 180.9)Signal transduction Two-component systems phosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 180.9)Regulatory functions DNA interactions heavy metal response regulator (TIGR01387; HMM-score: 151.1)and 7 moreproteobacterial dedicated sortase system response regulator (TIGR03787; HMM-score: 111.6)Cellular processes Sporulation and germination sporulation transcription factor Spo0A (TIGR02875; HMM-score: 67.1)Central intermediary metabolism Nitrogen metabolism nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 58.6)Regulatory functions DNA interactions nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 58.6)Signal transduction Two-component systems nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 58.6)Signal transduction Two-component systems TMAO reductase sytem sensor TorS (TIGR02956; EC 2.7.13.3; HMM-score: 50.6)Regulatory functions DNA interactions PEP-CTERM-box response regulator transcription factor (TIGR02915; HMM-score: 28.2)
- TheSEED :
- Response regulator SaeR (Staphylococcus exoprotein expression protein R)
- PFAM: CheY (CL0304) Response_reg; Response regulator receiver domain (PF00072; HMM-score: 101)HTH (CL0123) Trans_reg_C; Transcriptional regulatory protein, C terminal (PF00486; HMM-score: 90.6)and 4 moreCheY (CL0304) OKR_DC_1_N; Orn/Lys/Arg decarboxylase, N-terminal domain (PF03709; HMM-score: 22.7)EF_hand (CL0220) Caleosin; Caleosin related protein (PF05042; HMM-score: 13.4)no clan defined DUF2911; Protein of unknown function (DUF2911) (PF11138; HMM-score: 13.3)LMSTEN; LMSTEN motif (PF07988; HMM-score: 11.8)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors: SaeS (sensor histidine kinase) sensing human neutrophil peptides (HNPs) and hydrogen peroxide [1]
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.67
- Cytoplasmic Membrane Score: 0.01
- Cellwall Score: 0.15
- Extracellular Score: 0.17
- Internal Helices: 0
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.002662
- TAT(Tat/SPI): 0.000098
- LIPO(Sec/SPII): 0.000616
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MTHLLIVDDEQDIVDICQTYFEYEGYKVTTTTSGKEAISLLSNDIDIMVLDIMMPEVNGYDIVKEMKRQKLDIPFIYLTAKTQEHDTIYALTLGADDYVKKPFSPRELVLRINNLLTRMKKYHHQPVEQLSFDELTLINLSKVVTVNGHEVPMRIKEFELLWYLASRENEVISKSELLEKVWGYDYYEDANTVNVHIHRIREKLEKESFTTYTITTVWGLGYKFERSR
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas [3] [4]
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator: SaeR* (activation) regulon
SaeR* (TF) important in Virulence; RegPrecise transcription unit transferred from N315 data RegPrecise
⊟Transcription pattern[edit | edit source]
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Tobias Geiger, Christiane Goerke, Markus Mainiero, Dirk Kraus, Christiane Wolz
The virulence regulator Sae of Staphylococcus aureus: promoter activities and response to phagocytosis-related signals.
J Bacteriol: 2008, 190(10);3419-28
[PubMed:18344360] [WorldCat.org] [DOI] (I p) - ↑ 2.0 2.1 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
PLoS Genet: 2016, 12(4);e1005962
[PubMed:27035918] [WorldCat.org] [DOI] (I e) - ↑ Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
Proteomics: 2015, 15(21);3648-61
[PubMed:26224020] [WorldCat.org] [DOI] (I p) - ↑ Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
Sci Rep: 2017, 7(1);9718
[PubMed:28887440] [WorldCat.org] [DOI] (I e)
⊟Relevant publications[edit | edit source]
A T Giraudo, A Calzolari, A A Cataldi, C Bogni, R Nagel
The sae locus of Staphylococcus aureus encodes a two-component regulatory system.
FEMS Microbiol Lett: 1999, 177(1);15-22
[PubMed:10436918] [WorldCat.org] [DOI] (P p)C Goerke, U Fluckiger, A Steinhuber, W Zimmerli, C Wolz
Impact of the regulatory loci agr, sarA and sae of Staphylococcus aureus on the induction of alpha-toxin during device-related infection resolved by direct quantitative transcript analysis.
Mol Microbiol: 2001, 40(6);1439-47
[PubMed:11442841] [WorldCat.org] [DOI] (P p)Ana T Giraudo, Cecilia Mansilla, Ana Chan, Claudia Raspanti, Rosa Nagel
Studies on the expression of regulatory locus sae in Staphylococcus aureus.
Curr Microbiol: 2003, 46(4);246-50
[PubMed:12732971] [WorldCat.org] [DOI] (P p)Richard P Novick, Dunrong Jiang
The staphylococcal saeRS system coordinates environmental signals with agr quorum sensing.
Microbiology (Reading): 2003, 149(Pt 10);2709-2717
[PubMed:14523104] [WorldCat.org] [DOI] (P p)Andrea Steinhuber, Christiane Goerke, Manfred G Bayer, Gerd Döring, Christiane Wolz
Molecular architecture of the regulatory Locus sae of Staphylococcus aureus and its impact on expression of virulence factors.
J Bacteriol: 2003, 185(21);6278-86
[PubMed:14563862] [WorldCat.org] [DOI] (P p)Bret M Benton, J P Zhang, Skip Bond, Casey Pope, Todd Christian, Lawrence Lee, Kelly M Winterberg, Molly B Schmid, Jerry M Buysse
Large-scale identification of genes required for full virulence of Staphylococcus aureus.
J Bacteriol: 2004, 186(24);8478-89
[PubMed:15576798] [WorldCat.org] [DOI] (P p)Niamh Harraghy, Jan Kormanec, Christiane Wolz, Dagmar Homerova, Christiane Goerke, Knut Ohlsen, Saara Qazi, Philip Hill, Mathias Herrmann
sae is essential for expression of the staphylococcal adhesins Eap and Emp.
Microbiology (Reading): 2005, 151(Pt 6);1789-1800
[PubMed:15941988] [WorldCat.org] [DOI] (P p)Yan Q Xiong, Julie Willard, Michael R Yeaman, Ambrose L Cheung, Arnold S Bayer
Regulation of Staphylococcus aureus alpha-toxin gene (hla) expression by agr, sarA, and sae in vitro and in experimental infective endocarditis.
J Infect Dis: 2006, 194(9);1267-75
[PubMed:17041853] [WorldCat.org] [DOI] (P p)A T Giraudo, C G Raspanti, A Calzolari, R Nagel
Characterization of a Tn551-mutant of Staphylococcus aureus defective in the production of several exoproteins.
Can J Microbiol: 1994, 40(8);677-81
[PubMed:7922890] [WorldCat.org] [DOI] (P p)A T Giraudo, H Rampone, A Calzolari, R Nagel
Phenotypic characterization and virulence of a sae- agr- mutant of Staphylococcus aureus.
Can J Microbiol: 1996, 42(2);120-3
[PubMed:8742355] [WorldCat.org] [DOI] (P p)A T Giraudo, A L Cheung, R Nagel
The sae locus of Staphylococcus aureus controls exoprotein synthesis at the transcriptional level.
Arch Microbiol: 1997, 168(1);53-8
[PubMed:9211714] [WorldCat.org] [DOI] (P p)