⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL0766 [new locus tag: SACOL_RS03935 ]
- pan locus tag?: SAUPAN002591000
- symbol: saeR
- pan gene symbol?: saeR
- synonym:
- product: DNA-binding response regulator SaeR
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL0766 [new locus tag: SACOL_RS03935 ]
- symbol: saeR
- product: DNA-binding response regulator SaeR
- replicon: chromosome
- strand: -
- coordinates: 788786..789472
- length: 687
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3237800 NCBI
- RefSeq: YP_185643 NCBI
- BioCyc: see SACOL_RS03935
- MicrobesOnline: 912240 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661ATGACCCACTTACTGATCGTGGATGATGAACAAGACATTGTAGACATTTGTCAAACCTAT
TTTGAATATGAAGGTTACAAAGTAACAACGACAACTAGCGGTAAAGAAGCAATTTCTTTA
CTATCAAATGATATTGATATCATGGTACTTGATATCATGATGCCAGAAGTTAATGGTTAC
GACATTGTCAAAGAAATGAAAAGGCAAAAATTAGATATCCCCTTTATCTATTTAACTGCC
AAAACACAAGAACATGATACCATTTACGCCTTAACTTTAGGTGCAGATGACTATGTCAAA
AAACCATTTAGTCCAAGGGAACTCGTTTTACGTATTAATAATTTACTTACAAGAATGAAG
AAATACCATCATCAACCAGTTGAACAACTGTCGTTTGATGAATTAACACTTATTAACTTA
AGTAAAGTTGTGACTGTAAATGGTCACGAAGTCCCTATGCGTATTAAGGAATTTGAGTTA
TTGTGGTATTTAGCTTCTAGAGAAAATGAAGTTATTTCTAAATCAGAATTACTTGAAAAA
GTTTGGGGATATGACTATTACGAAGATGCTAATACCGTGAATGTCCATATACACCGTATT
AGAGAAAAATTAGAAAAAGAGAGCTTTACAACATATACCATCACAACTGTATGGGGATTA
GGATATAAATTTGAAAGGAGCCGATAA60
120
180
240
300
360
420
480
540
600
660
687
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL0766 [new locus tag: SACOL_RS03935 ]
- symbol: SaeR
- description: DNA-binding response regulator SaeR
- length: 228
- theoretical pI: 5.0506
- theoretical MW: 26857.6
- GRAVY: -0.339912
⊟Function[edit | edit source]
- TIGRFAM: Regulatory functions DNA interactions phosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 180.9)Signal transduction Two-component systems phosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 180.9)Regulatory functions DNA interactions heavy metal response regulator (TIGR01387; HMM-score: 151.1)and 7 moreproteobacterial dedicated sortase system response regulator (TIGR03787; HMM-score: 111.6)Cellular processes Sporulation and germination sporulation transcription factor Spo0A (TIGR02875; HMM-score: 67.1)Central intermediary metabolism Nitrogen metabolism nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 58.6)Regulatory functions DNA interactions nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 58.6)Signal transduction Two-component systems nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 58.6)Signal transduction Two-component systems TMAO reductase sytem sensor TorS (TIGR02956; EC 2.7.13.3; HMM-score: 50.6)Regulatory functions DNA interactions PEP-CTERM-box response regulator transcription factor (TIGR02915; HMM-score: 28.2)
- TheSEED :
- Response regulator SaeR (Staphylococcus exoprotein expression protein R)
- PFAM: CheY (CL0304) Response_reg; Response regulator receiver domain (PF00072; HMM-score: 103.7)HTH (CL0123) Trans_reg_C; Transcriptional regulatory protein, C terminal (PF00486; HMM-score: 93.1)and 4 moreCheY (CL0304) OKR_DC_1_N; Orn/Lys/Arg decarboxylase, N-terminal domain (PF03709; HMM-score: 21.4)EF_hand (CL0220) Caleosin; Caleosin related protein (PF05042; HMM-score: 14.5)no clan defined DUF2911; Protein of unknown function (DUF2911) (PF11138; HMM-score: 13.7)HTH (CL0123) GerE; Bacterial regulatory proteins, luxR family (PF00196; HMM-score: 12.3)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effector: SaeS (sensor histidine kinase)
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.67
- Cytoplasmic Membrane Score: 0.01
- Cellwall Score: 0.15
- Extracellular Score: 0.17
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9546
- Cytoplasmic Membrane Score: 0.0441
- Cell wall & surface Score: 0.0002
- Extracellular Score: 0.0011
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.002662
- TAT(Tat/SPI): 0.000098
- LIPO(Sec/SPII): 0.000616
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MTHLLIVDDEQDIVDICQTYFEYEGYKVTTTTSGKEAISLLSNDIDIMVLDIMMPEVNGYDIVKEMKRQKLDIPFIYLTAKTQEHDTIYALTLGADDYVKKPFSPRELVLRINNLLTRMKKYHHQPVEQLSFDELTLINLSKVVTVNGHEVPMRIKEFELLWYLASRENEVISKSELLEKVWGYDYYEDANTVNVHIHRIREKLEKESFTTYTITTVWGLGYKFERSR
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas
- protein localization: Cytoplasmic [1] [2] [3]
- quantitative data / protein copy number per cell: 64 [4]
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: saeS < saeR < SACOL0767
⊟Regulation[edit | edit source]
- regulator: SaeR (activation) regulon
SaeR (TF) important in Virulence; RegPrecise transcription unit transferred from N315 data RegPrecise
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
PLoS One: 2009, 4(12);e8176
[PubMed:19997597] [WorldCat.org] [DOI] (I e) - ↑ Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
J Proteome Res: 2011, 10(4);1657-66
[PubMed:21323324] [WorldCat.org] [DOI] (I p) - ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
The Staphylococcus aureus proteome.
Int J Med Microbiol: 2014, 304(2);110-20
[PubMed:24439828] [WorldCat.org] [DOI] (I p) - ↑ Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
Sci Rep: 2016, 6;28172
[PubMed:27344979] [WorldCat.org] [DOI] (I e)
⊟Relevant publications[edit | edit source]
Kathrin Rogasch, Vanessa Rühmling, Jan Pané-Farré, Dirk Höper, Christin Weinberg, Stephan Fuchs, Mareike Schmudde, Barbara M Bröker, Christiane Wolz, Michael Hecker, Susanne Engelmann
Influence of the two-component system SaeRS on global gene expression in two different Staphylococcus aureus strains.
J Bacteriol: 2006, 188(22);7742-58
[PubMed:17079681] [WorldCat.org] [DOI] (P p)Tobias Geiger, Christiane Goerke, Markus Mainiero, Dirk Kraus, Christiane Wolz
The virulence regulator Sae of Staphylococcus aureus: promoter activities and response to phagocytosis-related signals.
J Bacteriol: 2008, 190(10);3419-28
[PubMed:18344360] [WorldCat.org] [DOI] (I p)Julia Schmitt, Insa Joost, Eric P Skaar, Mathias Herrmann, Markus Bischoff
Haemin represses the haemolytic activity of Staphylococcus aureus in an Sae-dependent manner.
Microbiology (Reading): 2012, 158(Pt 10);2619-2631
[PubMed:22859613] [WorldCat.org] [DOI] (I p)
