From AureoWiki
Jump to navigation Jump to search

NCBI: 26-AUG-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA0661 [new locus tag: SA_RS03770 ]
  • pan locus tag?: SAUPAN002591000
  • symbol: saeR
  • pan gene symbol?: saeR
  • synonym:
  • product: response regulator

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA0661 [new locus tag: SA_RS03770 ]
  • symbol: saeR
  • product: response regulator
  • replicon: chromosome
  • strand: -
  • coordinates: 756335..757021
  • length: 687
  • essential: no DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGACCCACTTACTGATCGTGGATGATGAACAAGACATTGTAGACATTTGTCAAACCTAT
    TTTGAATATGAAGGTTACAAAGTAACAACGACAACTAGCGGTAAAGAAGCAATTTCTTTA
    CTATCAAATGATATTGATATCATGGTACTTGATATCATGATGCCAGAAGTTAATGGTTAC
    GACATTGTCAAAGAAATGAAAAGGCAAAAATTAGATATCCCCTTTATCTATTTAACTGCC
    AAAACACAAGAACATGATACCATTTACGCCTTAACTTTAGGTGCAGATGACTATGTCAAA
    AAACCATTTAGTCCAAGGGAACTCGTTTTACGTATTAATAATTTACTTACAAGAATGAAG
    AAATACCATCATCAACCAGTTGAACAACTGTCGTTTGATGAATTAACACTTATTAACTTA
    AGTAAAGTTGTGACTGTAAATGGTCACGAAGTCCCTATGCGTATTAAGGAATTTGAGTTA
    TTGTGGTATTTAGCTTCTAGAGAAAATGAAGTTATTTCTAAATCAGAATTACTTGAAAAA
    GTTTGGGGATATGACTATTACGAAGATGCTAATACCGTGAATGTCCATATACACCGTATT
    AGAGAAAAATTAGAAAAAGAGAGCTTTACAACATATACCATCACAACTGTATGGGGATTA
    GGATATAAATTTGAAAGGAGCCGATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    687

Protein[edit | edit source]

Protein Data Bank: 4QWQ

General[edit | edit source]

  • locus tag: SA0661 [new locus tag: SA_RS03770 ]
  • symbol: SaeR
  • description: response regulator
  • length: 228
  • theoretical pI: 5.0506
  • theoretical MW: 26857.6
  • GRAVY: -0.339912

Function[edit | edit source]

  • TIGRFAM:
    Signal transduction Regulatory functions DNA interactions phosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 180.9)
    Signal transduction Signal transduction Two-component systems phosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 180.9)
    Signal transduction Regulatory functions DNA interactions heavy metal response regulator (TIGR01387; HMM-score: 151.1)
    and 7 more
    proteobacterial dedicated sortase system response regulator (TIGR03787; HMM-score: 111.6)
    Cellular processes Cellular processes Sporulation and germination sporulation transcription factor Spo0A (TIGR02875; HMM-score: 67.1)
    Metabolism Central intermediary metabolism Nitrogen metabolism nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 58.6)
    Signal transduction Regulatory functions DNA interactions nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 58.6)
    Signal transduction Signal transduction Two-component systems nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 58.6)
    Signal transduction Signal transduction Two-component systems TMAO reductase sytem sensor TorS (TIGR02956; EC 2.7.13.3; HMM-score: 50.6)
    Signal transduction Regulatory functions DNA interactions PEP-CTERM-box response regulator transcription factor (TIGR02915; HMM-score: 28.2)
  • TheSEED:  
    Response regulator SaeR (Staphylococcus exoprotein expression protein R)
  • PFAM:
    CheY (CL0304) Response_reg; Response regulator receiver domain (PF00072; HMM-score: 101)
    HTH (CL0123) Trans_reg_C; Transcriptional regulatory protein, C terminal (PF00486; HMM-score: 90.6)
    and 4 more
    CheY (CL0304) OKR_DC_1_N; Orn/Lys/Arg decarboxylase, N-terminal domain (PF03709; HMM-score: 22.7)
    EF_hand (CL0220) Caleosin; Caleosin related protein (PF05042; HMM-score: 13.4)
    no clan defined DUF2911; Protein of unknown function (DUF2911) (PF11138; HMM-score: 13.3)
    LMSTEN; LMSTEN motif (PF07988; HMM-score: 11.8)

Structure, modifications & interactions[edit | edit source]

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.67
    • Cytoplasmic Membrane Score: 0.01
    • Cellwall Score: 0.15
    • Extracellular Score: 0.17
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.002662
    • TAT(Tat/SPI): 0.000098
    • LIPO(Sec/SPII): 0.000616
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MTHLLIVDDEQDIVDICQTYFEYEGYKVTTTTSGKEAISLLSNDIDIMVLDIMMPEVNGYDIVKEMKRQKLDIPFIYLTAKTQEHDTIYALTLGADDYVKKPFSPRELVLRINNLLTRMKKYHHQPVEQLSFDELTLINLSKVVTVNGHEVPMRIKEFELLWYLASRENEVISKSELLEKVWGYDYYEDANTVNVHIHRIREKLEKESFTTYTITTVWGLGYKFERSR

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator: SaeR (activation) regulon
    SaeR(TF)important in Virulence; RegPrecise  

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Tobias Geiger, Christiane Goerke, Markus Mainiero, Dirk Kraus, Christiane Wolz
    The virulence regulator Sae of Staphylococcus aureus: promoter activities and response to phagocytosis-related signals.
    J Bacteriol: 2008, 190(10);3419-28
    [PubMed:18344360] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]