From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_RS02565 [old locus tag: SAUSA300_0478 ]
  • pan locus tag?: SAUPAN002240000
  • symbol: SAUSA300_RS02565
  • pan gene symbol?: prs
  • synonym:
  • product: ribose-phosphate pyrophosphokinase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_RS02565 [old locus tag: SAUSA300_0478 ]
  • symbol: SAUSA300_RS02565
  • product: ribose-phosphate pyrophosphokinase
  • replicon: chromosome
  • strand: +
  • coordinates: 535146..536111
  • length: 966
  • essential: unknown

Accession numbers[edit | edit source]

  • Location: NC_007793 (535146..536111) NCBI
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    ATGTTAAATAATGAATATAAGAATTCGTCATTAAAGATTTTTTCATTGAAAGGAAACGAA
    GCATTAGCGCAAGAAGTTGCTGACCAAGTAGGAATTGAACTAGGTAAATGTTCAGTTAAA
    CGTTTTAGTGATGGAGAAATTCAAATTAATATCGAAGAGAGTATTCGTGGTTGTGACGTA
    TTTATTATTCAACCAACATCATATCCTGTGAATCTACATTTAATGGAATTATTAATTATG
    ATTGATGCTTGTAAACGTGCTTCTGCAGCAACAATCAATATTGTAGTGCCATATTATGGA
    TATGCAAGACAAGATAGAAAAGCCCGTAGCCGTGAGCCAATCACTGCTAAATTAGTTGCA
    AACTTAATCGAAACAGCTGGCGCAACTCGTATGATTGCGTTAGACTTACATGCACCACAA
    ATTCAAGGATTCTTTGATATTCCAATTGACCACTTAATGGGTGTGCCAATTCTTGCTAAA
    CATTTCAAAGATGATCCGAATATTAACCCAGAAGAATGTGTCGTTGTTTCACCAGACCAT
    GGCGGCGTTACACGTGCACGTAAATTAGCTGACATTTTAAAAACTCCAATTGCAATTATA
    GATAAACGTCGTCCTAGACCAAATGTTGCTGAAGTGATGAACATTGTTGGTGAGATTGAA
    GGACGTACGGCAATTATTATTGACGATATTATTGATACAGCAGGTACAATCACTTTAGCT
    GCACAAGCATTAAAAGATAAAGGTGCTAAAGAAGTATATGCTTGTTGTACACACCCTGTT
    TTATCAGGACCGGCTAAAGAACGTATCGAAAATTCTGCTATAAAAGAATTAATCGTAACA
    AACTCAATTCATTTAGATGAAGATCGCAAACCATCTAACACTAAAGAATTATCTGTTGCT
    GGTTTAATCGCACAAGCTATCATTCGTGTATACGAAAGAGAATCAGTTAGCGTATTATTT
    GACTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    966

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_RS02565 [old locus tag: SAUSA300_0478 ]
  • symbol: SAUSA300_RS02565
  • description: ribose-phosphate pyrophosphokinase
  • length: 321
  • theoretical pI: 6.17934
  • theoretical MW: 35283.6
  • GRAVY: -0.0314642

Function[edit | edit source]

  • reaction:
    EC 2.7.6.1?  ExPASy
    Ribose-phosphate diphosphokinase ATP + D-ribose 5-phosphate = AMP + 5-phospho-alpha-D-ribose 1-diphosphate
  • TIGRFAM:
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Purine ribonucleotide biosynthesis ribose-phosphate diphosphokinase (TIGR01251; EC 2.7.6.1; HMM-score: 420.2)
    and 7 more
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Pyrimidine ribonucleotide biosynthesis orotate phosphoribosyltransferase (TIGR01367; EC 2.4.2.10; HMM-score: 26.7)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Salvage of nucleosides and nucleotides hypoxanthine phosphoribosyltransferase (TIGR01203; EC 2.4.2.8; HMM-score: 21.8)
    Cellular processes Cellular processes DNA transformation comF family protein (TIGR00201; HMM-score: 20.1)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Pyrimidine ribonucleotide biosynthesis orotate phosphoribosyltransferase (TIGR00336; EC 2.4.2.10; HMM-score: 17.6)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Salvage of nucleosides and nucleotides adenine phosphoribosyltransferase (TIGR01090; EC 2.4.2.7; HMM-score: 15.6)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Purine ribonucleotide biosynthesis amidophosphoribosyltransferase (TIGR01134; EC 2.4.2.14; HMM-score: 13.2)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Salvage of nucleosides and nucleotides uracil phosphoribosyltransferase (TIGR01091; EC 2.4.2.9; HMM-score: 12.9)
  • TheSEED:
  • PFAM:
    PRTase-like (CL0533) Pribosyltran_N; N-terminal domain of ribose phosphate pyrophosphokinase (PF13793; HMM-score: 171.6)
    and 3 more
    Pribosyl_synth; Phosphoribosyl synthetase-associated domain (PF14572; HMM-score: 98.6)
    Pribosyltran; Phosphoribosyl transferase domain (PF00156; HMM-score: 75.7)
    UPRTase; Uracil phosphoribosyltransferase (PF14681; HMM-score: 14.8)

Structure, modifications & interactions[edit | edit source]

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.013988
    • TAT(Tat/SPI): 0.000517
    • LIPO(Sec/SPII): 0.00133
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI: 446856518 NCBI
  • RefSeq: WP_000933774 NCBI
  • UniProt:

Protein sequence[edit | edit source]

  • MLNNEYKNSSLKIFSLKGNEALAQEVADQVGIELGKCSVKRFSDGEIQINIEESIRGCDVFIIQPTSYPVNLHLMELLIMIDACKRASAATINIVVPYYGYARQDRKARSREPITAKLVANLIETAGATRMIALDLHAPQIQGFFDIPIDHLMGVPILAKHFKDDPNINPEECVVVSPDHGGVTRARKLADILKTPIAIIDKRRPRPNVAEVMNIVGEIEGRTAIIIDDIIDTAGTITLAAQALKDKGAKEVYACCTHPVLSGPAKERIENSAIKELIVTNSIHLDEDRKPSNTKELSVAGLIAQAIIRVYERESVSVLFD

Experimental data[edit | edit source]

  • experimentally validated: no data available

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. 1.000 1.001 1.002 1.003 1.004 1.005 1.006 1.007 1.008 1.009 1.010 1.011 1.012 1.013 1.014 1.015 1.016 1.017 1.018 1.019 1.020 1.021 1.022 1.023 1.024 1.025 1.026 1.027 1.028 1.029 1.030 1.031 1.032 1.033 1.034 1.035 1.036 1.037 1.038 1.039 1.040 1.041 1.042 1.043 1.044 1.045 1.046 1.047 1.048 1.049 1.050 1.051 1.052 1.053 1.054 1.055 1.056 1.057 1.058 1.059 1.060 1.061 1.062 1.063 1.064 1.065 1.066 1.067 1.068 1.069 1.070 1.071 1.072 1.073 1.074 1.075 1.076 1.077 1.078 1.079 1.080 1.081 1.082 1.083 1.084 1.085 1.086 1.087 1.088 1.089 1.090 1.091 1.092 1.093 1.094 1.095 1.096 1.097 1.098 1.099 1.100 1.101 1.102 1.103 1.104 1.105 1.106 1.107 1.108 1.109 1.110 1.111 1.112 1.113 1.114 1.115 1.116 1.117 1.118 1.119 1.120 1.121 1.122 1.123 1.124 1.125 1.126 1.127 1.128 1.129 1.130 1.131 1.132 1.133 1.134 1.135 1.136 1.137 1.138 1.139 1.140 1.141 1.142 1.143 1.144 1.145 1.146 1.147 1.148 1.149 1.150 1.151 1.152 1.153 1.154 1.155 1.156 1.157 1.158 1.159 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]