From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_0113 [new locus tag: NWMN_RS00625 ]
  • pan locus tag?: SAUPAN001003000
  • symbol: aldA
  • pan gene symbol?: aldA
  • synonym:
  • product: aldehyde dehydrogenase-like protein

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_0113 [new locus tag: NWMN_RS00625 ]
  • symbol: aldA
  • product: aldehyde dehydrogenase-like protein
  • replicon: chromosome
  • strand: +
  • coordinates: 137245..138732
  • length: 1488
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    ATGGCAGTAAACGTTCGAGATTATATTGCAGAGAATTATGGTTTATTTATCAATGGGGAA
    TTTGTTAAAGGTAGCAGTGACGAAACAATCGAAGTGACTAATCCAGCAACTGGAGAAACA
    CTATCACATATTACAAGAGCAAAAGATAAAGATGTCGATCATGCAGTCAAAGTGGCGCAA
    GAGGCATTTGAATCATGGTCATTAACTTCTAAATCAGAACGTGCACAAATGTTGCGTGAT
    ATTGGTGATAAATTAATGGCACAAAAAGATAAAATTGCAATGATTGAAACATTAAATAAT
    GGTAAACCGATTCGTGAGACAACAGCAATTGATATTCCATTTGCTGCAAGACATTTCCAT
    TATTTCGCAAGTGTTATTGAAACAGAAGAAGGTACAGTGAATGATATCGATAAAGACACA
    ATGAGTATCGTACGACATGAGCCGATTGGCGTCGTAGGTGCTGTTGTTGCTTGGAACTTC
    CCAATGCTATTAGCTGCATGGAAGATTGCGCCAGCCATTGCTGCAGGTAATACAATTGTG
    ATTCAACCTTCGTCTTCAACACCATTAAGTTTATTGGAAGTTGCTAAAATTTTCCAAGAG
    GTATTACCTAAAGGTGTTGTCAATATACTAACGGGTAAAGGTTCAGAATCAGGTAATGCA
    ATTTTCAATCATGATGGTGTAGATAAATTATCATTTACGGGCTCAACTGATGTAGGTTAT
    CAAGTTGCCGAAGCTGCAGCAAAACATCTAGTACCCGCTACATTAGAGCTTGGTGGTAAA
    AGCGCCAATATCATATTAGATGATGCTAATTTAGACCTTGCAGTTGAAGGTATTCAGTTA
    GGTATTTTATTCAACCAAGGTGAAGTATGTAGTGCAGGTTCTCGATTATTAGTTCATGAA
    AAAATTTATGATCAATTGGTGCCACGTTTACAAGAGGCATTTTCAAATATTAAAGTTGGA
    AATCCACAAGATGAAGCTACACAAATGGGTAGTCAAACTGGTAAGGATCAATTAGATAAA
    ATTCAATCATATATTGATGCAGCAAAAGAATCAGATGCACAAATTTTAGCAGGCGGTCAT
    CGCTTAACTGAAAATGGATTAGATAAAGGGTTCTTCTTTGAGCCGACATTAATTGCTGTG
    CCAGACAATCATCACAAATTAGCACAAGAAGAAATATTTGGACCAGTGTTAACAGTGATT
    AAAGTGAAGGACGATCAAGAAGCAATTGATATAGCTAATGATTCTGAGTATGGTTTAGCA
    GGCGGTGTATTTTCTCAAAATATCACACGTGCATTAAATATTGCTAAAGCTGTACGTACA
    GGACGTATTTGGATTAACACTTACAACCAAGTACCAGAAGGCGCACCATTTGGTGGTTAT
    AAAAAATCAGGTATCGGTCGAGAAACTTATAAAGGTGCGTTAAGTAACTATCAACAAGTT
    AAAAATATTTATATTGATACAAGCAATGCTTTAAAAGGTTTGTACTAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1488

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_0113 [new locus tag: NWMN_RS00625 ]
  • symbol: AldA
  • description: aldehyde dehydrogenase-like protein
  • length: 495
  • theoretical pI: 4.90708
  • theoretical MW: 53658.2
  • GRAVY: -0.171717

Function[edit source | edit]

  • reaction:
  • TIGRFAM:
    Cellular processesCellular processesAdaptations to atypical conditionsbetaine-aldehyde dehydrogenase (TIGR01804; EC 1.2.1.8; HMM-score: 518.9)
    5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase (TIGR02299; EC 1.2.1.60; HMM-score: 439.6)
    MetabolismEnergy metabolismOther2-hydroxymuconic semialdehyde dehydrogenase (TIGR03216; EC 1.2.1.-; HMM-score: 379.4)
    MetabolismCentral intermediary metabolismOthersuccinate-semialdehyde dehydrogenase (TIGR01780; EC 1.2.1.-; HMM-score: 369.5)
    1-pyrroline dehydrogenase (TIGR03374; EC 1.2.1.19; HMM-score: 367.9)
    Unknown functionEnzymes of unknown specificityaldehyde dehydrogenase, Rv0768 family (TIGR04284; EC 1.2.1.-; HMM-score: 349.7)
    MetabolismEnergy metabolismAmino acids and aminesputative delta-1-pyrroline-5-carboxylate dehydrogenase (TIGR01237; EC 1.2.1.88; HMM-score: 308.7)
    MetabolismEnergy metabolismAmino acids and aminesmethylmalonate-semialdehyde dehydrogenase (acylating) (TIGR01722; EC 1.2.1.27; HMM-score: 248.5)
    putative phosphonoacetaldehyde dehydrogenase (TIGR03250; EC 1.2.1.-; HMM-score: 234.3)
    MetabolismEnergy metabolismAmino acids and aminessuccinylglutamate-semialdehyde dehydrogenase (TIGR03240; EC 1.2.1.71; HMM-score: 226.9)
    MetabolismEnergy metabolismAmino acids and aminesdelta-1-pyrroline-5-carboxylate dehydrogenase (TIGR01238; EC 1.2.1.88; HMM-score: 192.6)
    MetabolismEnergy metabolismAmino acids and amines1-pyrroline-5-carboxylate dehydrogenase (TIGR01236; EC 1.2.1.88; HMM-score: 183.5)
    phenylacetic acid degradation protein paaN (TIGR02278; HMM-score: 122.3)
    acetaldehyde dehydrogenase (acetylating) (TIGR02518; EC 1.2.1.10; HMM-score: 42.7)
    phenylacetic acid degradation protein paaN (TIGR02288; HMM-score: 30.3)
    MetabolismAmino acid biosynthesisGlutamate familyglutamate-5-semialdehyde dehydrogenase (TIGR00407; EC 1.2.1.41; HMM-score: 26.5)
  • TheSEED:  
    CarbohydratesCentral carbohydrate metabolismMethylglyoxal Metabolism Aldehyde dehydrogenase B (EC 1.2.1.22) 
    Fatty Acids, Lipids, and IsoprenoidsPhospholipidsGlycerolipid and Glycerophospholipid Metabolism in Bacteria Aldehyde dehydrogenase B (EC 1.2.1.22) 
  • PFAM:
    ALDH-like (CL0099) Aldedh; Aldehyde dehydrogenase family (PF00171; HMM-score: 575.7)
    LuxC; Acyl-CoA reductase (LuxC) (PF05893; HMM-score: 11.8)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    NWMN_1605(ackA)acetate kinase  [1] (data from MRSA252)
    NWMN_1483(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    NWMN_1096(ftsZ)cell division protein FtsZ  [1] (data from MRSA252)
    NWMN_0509(fus)elongation factor G  [1] (data from MRSA252)
    NWMN_2499(ldh)L-lactate dehydrogenase 2  [1] (data from MRSA252)
    NWMN_0962(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    NWMN_0162(pflB)formate acetyltransferase  [1] (data from MRSA252)
    NWMN_0959(phdA)pyruvate dehydrogenase E1 component, alpha subunit  [1] (data from MRSA252)
    NWMN_1592(pykA)pyruvate kinase  [1] (data from MRSA252)
    NWMN_0500(rplA)50S ribosomal protein L1  [1] (data from MRSA252)
    NWMN_2149(rplB)50S ribosomal protein L2  [1] (data from MRSA252)
    NWMN_2140(rplE)50S ribosomal protein L5  [1] (data from MRSA252)
    NWMN_2137(rplF)50S ribosomal protein L6  [1] (data from MRSA252)
    NWMN_0501(rplJ)50S ribosomal protein L10  [1] (data from MRSA252)
    NWMN_2133(rplO)50S ribosomal protein L15  [1] (data from MRSA252)
    NWMN_2125(rplQ)50S ribosomal protein L17  [1] (data from MRSA252)
    NWMN_1151(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    NWMN_1549(rplU)50S ribosomal protein L21  [1] (data from MRSA252)
    NWMN_2147(rplV)50S ribosomal protein L22  [1] (data from MRSA252)
    NWMN_2150(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    NWMN_2024(rpmE2)50S ribosomal protein L31 type B  [1] (data from MRSA252)
    NWMN_0505(rpoC)DNA-directed RNA polymerase subunit beta'  [1] (data from MRSA252)
    NWMN_1166(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    NWMN_2146(rpsC)30S ribosomal protein S3  [1] (data from MRSA252)
    NWMN_2135(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    NWMN_2119(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    NWMN_2127(rpsK)30S ribosomal protein S11  [1] (data from MRSA252)
    NWMN_2143(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    NWMN_0510(tufA)elongation factor Tu  [1] (data from MRSA252)
    NWMN_2016(upp)uracil phosphoribosyltransferase  [1] (data from MRSA252)
    NWMN_0811hypothetical protein  [1] (data from MRSA252)
    NWMN_1382DNA-binding protein HU  [1] (data from MRSA252)
    NWMN_1672putative translaldolase  [1] (data from MRSA252)
    NWMN_2086alkaline shock protein 23  [1] (data from MRSA252)
    NWMN_2504malate:quinone oxidoreductase  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.67
    • Cytoplasmic Membrane Score: 0.01
    • Cellwall Score: 0.15
    • Extracellular Score: 0.17
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.113
    • Ymax_pos: 39
    • Cmax: 0.134
    • Cmax_pos: 25
    • Smax: 0.151
    • Smax_pos: 24
    • Smean: 0.094
    • D: 0.106
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MAVNVRDYIAENYGLFINGEFVKGSSDETIEVTNPATGETLSHITRAKDKDVDHAVKVAQEAFESWSLTSKSERAQMLRDIGDKLMAQKDKIAMIETLNNGKPIRETTAIDIPFAARHFHYFASVIETEEGTVNDIDKDTMSIVRHEPIGVVGAVVAWNFPMLLAAWKIAPAIAAGNTIVIQPSSSTPLSLLEVAKIFQEVLPKGVVNILTGKGSESGNAIFNHDGVDKLSFTGSTDVGYQVAEAAAKHLVPATLELGGKSANIILDDANLDLAVEGIQLGILFNQGEVCSAGSRLLVHEKIYDQLVPRLQEAFSNIKVGNPQDEATQMGSQTGKDQLDKIQSYIDAAKESDAQILAGGHRLTENGLDKGFFFEPTLIAVPDNHHKLAQEEIFGPVLTVIKVKDDQEAIDIANDSEYGLAGGVFSQNITRALNIAKAVRTGRIWINTYNQVPEGAPFGGYKKSGIGRETYKGALSNYQQVKNIYIDTSNALKGLY

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: CcpA
    CcpA (TF) important in Carbon catabolism  RegPrecise

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34

Relevant publications[edit source | edit]