From AureoWiki
Jump to: navigation, search
NCBI: 06-JUL-2013

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_1268 [new locus tag: NWMN_RS07145 ]
  • pan locus tag?: SAUPAN003742000
  • symbol: parC
  • pan gene symbol?: parC
  • synonym:
  • product: DNA topoisomerase IV subunit A

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_1268 [new locus tag: NWMN_RS07145 ]
  • symbol: parC
  • product: DNA topoisomerase IV subunit A
  • replicon: chromosome
  • strand: +
  • coordinates: 1394152..1396554
  • length: 2403
  • essential: unknown other strains

Accession numbers[edit source | edit]

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    2161
    2221
    2281
    2341
    2401
    GTGAGTGAAATAATTCAAGATTTATCACTTGAAGATGTTTTAGGTGATCGCTTTGGAAGA
    TATAGTAAATATATTATTCAAGAGCGTGCATTGCCAGATGTTCGTGATGGTTTAAAACCA
    GTACAACGTCGTATTTTATATGCAATGTATTCAAGTGGTAATACACACGATAAAAATTTC
    CGTAAAAGTGCGAAAACAGTCGGTGATGTTATTGGTCAATATCATCCACATGGAGACTCC
    TCAGTGTACGAAGCAATGGTCCGTTTAAGTCAAGACTGGAAGTTACGACATGTCTTAATA
    GAAATGCATGGTAATAATGGTAGTATCGATAATGATCCGCCAGCGGCAATGCGTTACACT
    GAAGCTAAGTTAAGCTTACTAGCTGAAGAGTTATTACGTGATATTAATAAAGAGACAGTT
    TCTTTCATTCCAAACTATGATGATACGACACTCGAACCAATGGTATTGCCATCAAGATTT
    CCTAACTTACTAGTGAATGGTTCTACAGGTATATCTGCAGGTTACGCGACAGATATACCA
    CCACATAATTTAGCTGAAGTGATTCAAGCAACACTTAAATATATTGATAATCCGGATATT
    ACAGTCAATCAATTAATGAAATATATTAAAGGTCCTGATTTTCCAACTGGTGGTATTATT
    CAAGGTATTGATGGTATTAAAAAAGCTTATGAATCAGGTAAAGGTAGAATTATAGTTCGT
    TCTAAAGTTGAAGAAGAAACTTTACGCAATGGACGTAAACAGTTAATTATTACTGAAATT
    CCATATGAAGTGAACAAAAGTAGCTTAGTAAAACGTATCGATGAATTACGTGCTGACAAA
    AAAGTCGATGGTATCGTTGAAGTACGTGATGAAACTGATAGAACTGGTTTACGAATAGCA
    ATTGAATTGAAAAAAGATGTGAACAGTGAATCAATCAAAAATTATCTTTATAAAAACTCT
    GATTTACAGATTTCATATAATTTCAACATGGTCGCTATTAGTGATGGTCGTCCAAAATTG
    ATGGGTATTCGTCAAATTATAGATAGTTATTTGAATCACCAAATTGAGGTTGTTGCAAAT
    AGAACGAAGTTTGAATTAGATAATGCAGAAAAACGTATGCATATCGTTGAAGGTTTGATT
    AAAGCGTTGTCAATTTTAGATAAAGTAATCGAATTGATTCGTAGCTCTAAAAACAAGCGT
    GACGCTAAAGAAAACCTTATCGAAGTATACGAGTTCACAGAAGAACAGGCTGAAGCAATT
    GTAATGTTACAGTTATATCGTTTAACAAATACTGACATAGTTGCGCTTGAAGGTGAACAT
    AAAGAACTTGAAGCATTAATCAAACAATTACGTCATATTCTTGATAACCATGATGCATTA
    TTGAATGTCATAAAAGAAGAATTGAATGAAATTAAAAAGAAATTCAAATCTGAACGACTG
    TCTTTAATTGAAGCAGAAATTGAAGAAATTAAAATTGACAAAGAAGTTATGGTGCCTAGT
    GAAGAAGTTATTTTAAGTATGACACGTCATGGATATATTAAACGTACTTCTATTCGTAGC
    TTTAATGCTAGCGGTGTTGAAGATATTGGTTTAAAAGATGGTGACAGTTTACTTAAACAT
    CAAGAAGTAAATACGCAAGATACCGTACTAGTATTTACAAATAAAGGTCGTTATCTATTT
    ATACCGGTTCATAAATTAGCAGATATTCGTTGGAAAGAATTGGGACAACATGTATCACAA
    ATAGTTCCTATCGAAGAAGATGAAGTGGTTATTAATGTCTTTAATGAAAAGGACTTTAAT
    ACAGATGCATTTTATGTTTTTGCGACTCAAAATGGCATGATTAAGAAAAGTACAGTGCCT
    CTATTTAAAACAACGCGTTTTAATAAACCTTTAATTGCTACTAAAGTTAAAGAAAATGAT
    GATTTGATTAGTGTTATGCGCTTTGAAAAAGATCAATTAATTACCGTCATTACTAATAAA
    GGTATGTCATTAACGTATAATACAAGTGAACTATCAGATACCGGATTAAGGGCAGCTGGT
    GTTAAATCAATAAATCTTAAAGCTGAAGATTTCGTTGTTATGACAGAAGGTGTTTCTGAA
    AATGATACTATATTGATGGCCACACAACGCGGCTCGTTAAAACGTATTAGTTTTAAAATC
    TTACAAGTTGCTAAAAGAGCACAACGTGGAATAACTTTATTAAAAGAATTAAAGAAAAAT
    CCACATCGTATTGTAGCTGCACATGTAGTGACAGGTGAACATAGTCAATATACATTATAT
    TCAAAATCAAATGAAGAACATGGTTTAATTAATGATATTCATAAATCTGAACAATATACA
    AATGGCTCATTCATTGTAGATACAGATGATTTTGGTGAAGTAATAGACATGTATATTAGC
    TAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2160
    2220
    2280
    2340
    2400
    2403

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_1268 [new locus tag: NWMN_RS07145 ]
  • symbol: ParC
  • description: DNA topoisomerase IV subunit A
  • length: 800
  • theoretical pI: 6.37111
  • theoretical MW: 90997.4
  • GRAVY: -0.382375

Function[edit source | edit]

  • reaction:
    EC 5.99.1.3?  ExPASy
    DNA topoisomerase (ATP-hydrolyzing)ATP-dependent breakage, passage and rejoining of double-stranded DNA
  • TIGRFAM:
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA topoisomerase IV, A subunit (TIGR01061; EC 5.99.1.-; HMM-score: 1054.4)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA gyrase, A subunit (TIGR01063; EC 5.99.1.3; HMM-score: 859.8)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA topoisomerase IV, A subunit (TIGR01062; EC 5.99.1.-; HMM-score: 511.5)
    hemerythrin-like metal-binding domain (TIGR02481; HMM-score: 13.1)
  • TheSEED:  
    DNA MetabolismDNA replicationDNA topoisomerases, Type II, ATP-dependent Topoisomerase IV subunit A (EC 5.99.1.-) 
    Virulence, Disease and DefenseResistance to antibiotics and toxic compoundsResistance to fluoroquinolones Topoisomerase IV subunit A (EC 5.99.1.-) 
  • PFAM:
    no clan definedDNA_topoisoIV; DNA gyrase/topoisomerase IV, subunit A (PF00521; HMM-score: 505.9)
    DNA_gyraseA_C; DNA gyrase C-terminal domain, beta-propeller (PF03989; HMM-score: 84.9)
    AA_dh_N (CL0603) THF_DHG_CYH; Tetrahydrofolate dehydrogenase/cyclohydrolase, catalytic domain (PF00763; HMM-score: 15.5)
    no clan definedFliT; Flagellar protein FliT (PF05400; HMM-score: 13.5)
    Concanavalin (CL0004) Polysacc_lyase; Polysaccharide lyase (PF14099; HMM-score: 12.1)
    no clan definedNoelin-1; Neurogenesis glycoprotein (PF12308; HMM-score: 11.6)
    Thioredoxin (CL0172) DUF2703; Domain of unknown function (DUF2703) (PF10865; HMM-score: 9.7)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    NWMN_2534(arcA)arginine deiminase  [1] (data from MRSA252)
    NWMN_1587(citC)isocitrate dehydrogenase  [1] (data from MRSA252)
    NWMN_1483(dnaK)molecular chaperone DnaK  [1] (data from MRSA252)
    NWMN_0002(dnaN)DNA polymerase III subunit beta  [1] (data from MRSA252)
    NWMN_0745(eno)phosphopyruvate hydratase  [1] (data from MRSA252)
    NWMN_2003(fabZ)(3R)-hydroxymyristoyl-ACP dehydratase  [1] (data from MRSA252)
    NWMN_0509(fus)elongation factor G  [1] (data from MRSA252)
    NWMN_1580(gapB)glyceraldehyde 3-phosphate dehydrogenase 2  [1] (data from MRSA252)
    NWMN_1838(gatA)aspartyl/glutamyl-tRNA amidotransferase subunit A  [1] (data from MRSA252)
    NWMN_1837(gatB)aspartyl/glutamyl-tRNA amidotransferase subunit B  [1] (data from MRSA252)
    NWMN_1217(glnA)glutamine synthetase  [1] (data from MRSA252)
    NWMN_0005(gyrA)DNA gyrase A subunit  [1] (data from MRSA252)
    NWMN_0004(gyrB)DNA gyrase B subunit  [1] (data from MRSA252)
    NWMN_2499(ldh)L-lactate dehydrogenase 2  [1] (data from MRSA252)
    NWMN_0176(ldh1)L-lactate dehydrogenase  [1] (data from MRSA252)
    NWMN_1680(metK)S-adenosylmethionine synthetase  [1] (data from MRSA252)
    NWMN_2004(murA)UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [1] (data from MRSA252)
    NWMN_2446(mvaS)3-hydroxy-3-methylglutaryl coenzyme A synthase  [1] (data from MRSA252)
    NWMN_0962(pdhD)dihydrolipoamide dehydrogenase  [1] (data from MRSA252)
    NWMN_2040(pdp)pyrimidine-nucleoside phosphorylase  [1] (data from MRSA252)
    NWMN_0959(phdA)pyruvate dehydrogenase E1 component, alpha subunit  [1] (data from MRSA252)
    NWMN_0463(prs)ribose-phosphate pyrophosphokinase  [1] (data from MRSA252)
    NWMN_1592(pykA)pyruvate kinase  [1] (data from MRSA252)
    NWMN_2125(rplQ)50S ribosomal protein L17  [1] (data from MRSA252)
    NWMN_1151(rplS)50S ribosomal protein L19  [1] (data from MRSA252)
    NWMN_2150(rplW)50S ribosomal protein L23  [1] (data from MRSA252)
    NWMN_2134(rpmD)50S ribosomal protein L30  [1] (data from MRSA252)
    NWMN_0505(rpoC)DNA-directed RNA polymerase subunit beta'  [1] (data from MRSA252)
    NWMN_1385(rpsA)30S ribosomal protein S1  [1] (data from MRSA252)
    NWMN_1166(rpsB)30S ribosomal protein S2  [1] (data from MRSA252)
    NWMN_2135(rpsE)30S ribosomal protein S5  [1] (data from MRSA252)
    NWMN_0508(rpsG)30S ribosomal protein S7  [1] (data from MRSA252)
    NWMN_2119(rpsI)30S ribosomal protein S9  [1] (data from MRSA252)
    NWMN_0507(rpsL)30S ribosomal protein S12  [1] (data from MRSA252)
    NWMN_2143(rpsQ)30S ribosomal protein S17  [1] (data from MRSA252)
    NWMN_0510(tufA)elongation factor Tu  [1] (data from MRSA252)
    NWMN_02495'-nucleotidase, lipoprotein e(P4) family protein  [1] (data from MRSA252)
    NWMN_0475cysteine synthase-like protein  [1] (data from MRSA252)
    NWMN_0641hypothetical protein  [1] (data from MRSA252)
    NWMN_0655MarR family regulatory protein  [1] (data from MRSA252)
    NWMN_0811hypothetical protein  [1] (data from MRSA252)
    NWMN_0839fumarylacetoacetate hydrolase family protein  [1] (data from MRSA252)
    NWMN_0881enoyl-(acyl carrier protein) reductase  [1] (data from MRSA252)
    NWMN_0949phosphocarrier protein HPr  [1] (data from MRSA252)
    NWMN_1382DNA-binding protein HU  [1] (data from MRSA252)
    NWMN_1604universal stress protein family protein  [1] (data from MRSA252)
    NWMN_2086alkaline shock protein 23  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular Possibility: 1
    • Signal Peptide Possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • Ymax: 0.098
    • Ymax_pos: 69
    • Cmax: 0.106
    • Cmax_pos: 64
    • Smax: 0.113
    • Smax_pos: 61
    • Smean: 0.07
    • D: 0.087
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

Protein sequence[edit source | edit]

  • MSEIIQDLSLEDVLGDRFGRYSKYIIQERALPDVRDGLKPVQRRILYAMYSSGNTHDKNFRKSAKTVGDVIGQYHPHGDSSVYEAMVRLSQDWKLRHVLIEMHGNNGSIDNDPPAAMRYTEAKLSLLAEELLRDINKETVSFIPNYDDTTLEPMVLPSRFPNLLVNGSTGISAGYATDIPPHNLAEVIQATLKYIDNPDITVNQLMKYIKGPDFPTGGIIQGIDGIKKAYESGKGRIIVRSKVEEETLRNGRKQLIITEIPYEVNKSSLVKRIDELRADKKVDGIVEVRDETDRTGLRIAIELKKDVNSESIKNYLYKNSDLQISYNFNMVAISDGRPKLMGIRQIIDSYLNHQIEVVANRTKFELDNAEKRMHIVEGLIKALSILDKVIELIRSSKNKRDAKENLIEVYEFTEEQAEAIVMLQLYRLTNTDIVALEGEHKELEALIKQLRHILDNHDALLNVIKEELNEIKKKFKSERLSLIEAEIEEIKIDKEVMVPSEEVILSMTRHGYIKRTSIRSFNASGVEDIGLKDGDSLLKHQEVNTQDTVLVFTNKGRYLFIPVHKLADIRWKELGQHVSQIVPIEEDEVVINVFNEKDFNTDAFYVFATQNGMIKKSTVPLFKTTRFNKPLIATKVKENDDLISVMRFEKDQLITVITNKGMSLTYNTSELSDTGLRAAGVKSINLKAEDFVVMTEGVSENDTILMATQRGSLKRISFKILQVAKRAQRGITLLKELKKNPHRIVAAHVVTGEHSQYTLYSKSNEEHGLINDIHKSEQYTNGSFIVDTDDFGEVIDMYIS

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

Regulation[edit source | edit]

  • sigma factor:
  • regulator: LexA
    LexA (TF) important in SOS response

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38 1.39 1.40 1.41 1.42 1.43 1.44 1.45 1.46 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]