From AureoWiki
Jump to: navigation, search
NCBI: 02-MAR-2017

Summary[edit source | edit]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS05965 [old locus tag: NWMN_1056 ]
  • pan locus tag?: SAUPAN003382000
  • symbol: NWMN_RS05965
  • pan gene symbol?: mutS2
  • synonym:
  • product: endonuclease MutS2

Genome View[edit source | edit]

Gene[edit source | edit]

General[edit source | edit]

  • type: CDS
  • locus tag: NWMN_RS05965 [old locus tag: NWMN_1056 ]
  • symbol: NWMN_RS05965
  • product: endonuclease MutS2
  • replicon: chromosome
  • strand: +
  • coordinates: 1159258..1161606
  • length: 2349
  • essential: unknown

Accession numbers[edit source | edit]

  • Location: NC_009641 (1159258..1161606) NCBI
  • MicrobesOnline:

Phenotype[edit source | edit]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit source | edit]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    1621
    1681
    1741
    1801
    1861
    1921
    1981
    2041
    2101
    2161
    2221
    2281
    2341
    ATGAGACAAAAAACATTAGACGTCTTAGAATTTGAAAAAATAAAATCACTCGTTGCCAAT
    GAAACTATTAGTGACTTAGGCTTGGAAAAGGTCAATCAAATGATGCCAGCTACTAATTTT
    GAAACGGTTGTTTTTCAAATGGAAGAAACGGATGAGATTGCTCAAATCTATAATAAGCAT
    CGTTTACCAAGCTTGAGTGGCTTATCTAAAGTATCAGCATTCATTCATCGCGCTGATATT
    GGCGGCGTTTTAAATGTATCAGAGCTTAACTTGATAAAAAGATTAATTCAAGTACAAAAT
    CAATTCAAGACATTTTATAATCAATTGGTTGAAGAAGATGAAGGTGTTAAATACCCAATA
    TTAGATGACAAGATGAATCAATTACCTGTGTTAACTGATCTTTTTCAACAAATAAATGAA
    ACATGCGATACGTATGATTTATATGATAATGCGAGTTATGAATTGCAAGGGATTAGAAGT
    AAAATTTCTAGCACGAATCAACGTATTAGACAAAATTTGGACCGTATTGTTAAAAGCCAA
    GCAAATCAGAAAAAATTATCAGATGCTATTGTAACAGTTAGGAATGAAAGAAACGTTATA
    CCTGTCAAAGCTGAATATCGACAAGATTTTAATGGGATTGTACATGATCAATCTGCTTCA
    GGACAAACATTGTATATTGAGCCATCATCAGTTGTTGAAATGAATAATCAAATTAGTCGA
    TTACGTCATGACGAAGCAATTGAAAAAGAACGCATTTTAACGCAACTAACTGGTTATGTG
    GCTGCGGACAAAGATGCACTACTTGTGGCAGAACAAGTCATGGGTCAGTTAGATTTTTTA
    ATCGCAAAAGCGAGATATAGTAGAAGTATTAAAGGAACAAAGCCGATATTTAAAGAGGAC
    CGTACTGTATATTTACCTAAAGCATACCATCCATTATTAAATCGTGAGACTGTTGTAGCT
    AATACCATCGAATTTATGGAAGATATTGAAACGGTAATTATTACAGGACCGAATACAGGT
    GGTAAAACTGTAACATTAAAAACATTAGGTTTAATTATTGTTATGGCTCAATCAGGATTG
    TTGATTCCCACACTTGATGGTAGTCAGTTAAGTGTATTTAAAAATGTATATTGCGATATC
    GGAGATGAACAATCAATAGAACAATCATTATCAACTTTTTCATCTCATATGACGAATATA
    GTTGAAATTTTAAAGCATGCAGACAAACATAGTTTAGTTTTATTTGATGAATTAGGTGCA
    GGTACAGATCCGAGTGAAGGTGCTGCATTAGCAATGAGCATTTTAGATCATGTTAGAAAA
    ATTGGTTCTCTAGTAATGGCAACGACGCACTATCCTGAACTTAAAGCATATAGTTATAAT
    CGAGAAGGCGTTATGAATGCGAGTGTAGAATTTGATGTAGATACTTTGAGTCCAACGTAT
    AAGTTATTAATGGGTGTGCCGGGTCGTTCAAATGCTTTTGACATTTCTAAAAAGTTAGGT
    CTTAGTTTGAATATTATTAATAAGGCTAAGACGATGATTGGTACTGATGAAAAAGAAATA
    AATGAAATGATTGAATCATTAGAGCGTAATTACAAACGTGTAGAGACACAGAGGTTAGAA
    CTGGACCGTCTTGTAAAAGAAGCGGAGCAAGTGCATGATGATTTATCTAAGCAGTATCAA
    CAATTCCAAAATTATGAAAAGTCTCTAATAGAGGAAGCGAAAGAAAAAGCAAATCAGAAG
    ATTAAGGCTGCAACAAAAGAAGCTGACGATATTATTAAAGACTTAAGACAATTGCGTGAA
    CAAAAAGGTGCAGATGTTAAAGAACATGAATTGATTGATAAGAAGAAACGATTAGATGAT
    CATTATGAAGCGAAATCTATAAAGCAAAATGTACAAAAGCAAAAATACGATAAAATTGTT
    GCTGGTGATGAAGTAAAAGTATTATCTTACGGTCAAAAGGGTGAAGTTTTAGAAATTGTC
    AATGATGAAGAAGCAATTGTTCAAATGGGAATTATTAAAATGAAGTTACCTATTGAAGAT
    TTAGAGAAAAAACAAAAAGAAAAAGTTAAGCCAACGAAAATGGTTACACGTCAAAATCGT
    CAAACAATTAAAACTGAACTTGACTTACGAGGCTATCGTTATGAGGATGCTTTAATTGAA
    CTAGATCAATATTTAGATCAAGCCGTTTTAAGTAATTACGAACAAGTTTATATCATTCAT
    GGTAAAGGTACAGGTGCACTTCAAAAAGGTGTACAACAACATTTGAAAAAGCATAAAAGT
    GTTAGTGACTTTAGAGGTGGTATGCCAAGCGAAGGTGGATTTGGCGTTACCGTTGCAACA
    CTAAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1620
    1680
    1740
    1800
    1860
    1920
    1980
    2040
    2100
    2160
    2220
    2280
    2340
    2349

Protein[edit source | edit]

General[edit source | edit]

  • locus tag: NWMN_RS05965 [old locus tag: NWMN_1056 ]
  • symbol: NWMN_RS05965
  • description: endonuclease MutS2
  • length: 782
  • theoretical pI: 6.14125
  • theoretical MW: 88660.6
  • GRAVY: -0.469437

Function[edit source | edit]

  • reaction:
    EC 3.1.-.-?  ExPASy
  • TIGRFAM:
    Genetic information processingDNA metabolismOtherMutS2 family protein (TIGR01069; HMM-score: 784.5)
    Genetic information processingDNA metabolismDNA replication, recombination, and repairDNA mismatch repair protein MutS (TIGR01070; HMM-score: 139.8)
    Genetic information processingProtein fateProtein and peptide secretion and traffickingheme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 13.2)
    MetabolismTransport and binding proteinsOtherheme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 13.2)
    Cellular processesCellular processesPathogenesisvirulence factor Mce family protein (TIGR00996; HMM-score: 12.5)
  • TheSEED:
  • PFAM:
    P-loop_NTPase (CL0023) MutS_V; MutS domain V (PF00488; HMM-score: 122.9)
    no clan definedSmr; Smr domain (PF01713; HMM-score: 68.7)
    DUF2935; Domain of unknown function (DUF2935) (PF11155; HMM-score: 15.9)
    P-loop_NTPase (CL0023) AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 13.6)
    no clan definedSpc7; Spc7 kinetochore protein (PF08317; HMM-score: 13.3)
    PilJ; Type IV pili methyl-accepting chemotaxis transducer N-term (PF13675; HMM-score: 11.1)
    YtxH; YtxH-like protein (PF12732; HMM-score: 10)
    IncA; IncA protein (PF04156; HMM-score: 9.5)
    DUF2203; Uncharacterized conserved protein (DUF2203) (PF09969; HMM-score: 9.5)
    VSG_B; Trypanosomal VSG domain (PF13206; HMM-score: 8)
    BRE1; BRE1 E3 ubiquitin ligase (PF08647; HMM-score: 7.6)
    YjbJ-CsbD-like (CL0406) DUF883; Bacterial protein of unknown function (DUF883) (PF05957; HMM-score: 7.6)

Structure, modifications & interactions[edit source | edit]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • protein partners:
    NWMN_RS10565(gatA)glutamyl-tRNA(Gln) amidotransferase subunit A  [1] (data from MRSA252)
    NWMN_RS00885formate acetyltransferase  [1] (data from MRSA252)
    NWMN_RS0291550S ribosomal protein L1  [1] (data from MRSA252)
    NWMN_RS02965elongation factor Tu  [1] (data from MRSA252)
    NWMN_RS03640LysR family transcriptional regulator  [1] (data from MRSA252)
    NWMN_RS04590NADH dehydrogenase  [1] (data from MRSA252)
    NWMN_RS04730hypothetical protein  [1] (data from MRSA252)
    NWMN_RS05380pyruvate dehydrogenase E1 component subunit alpha  [1] (data from MRSA252)
    NWMN_RS06210cell division protein FtsZ  [1] (data from MRSA252)
    NWMN_RS0657530S ribosomal protein S2  [1] (data from MRSA252)
    NWMN_RS07455dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex  [1] (data from MRSA252)
    NWMN_RS08865aldehyde dehydrogenase  [1] (data from MRSA252)
    NWMN_RS08905isocitrate dehydrogenase (NADP(+))  [1] (data from MRSA252)
    NWMN_RS08930pyruvate kinase  [1] (data from MRSA252)
    NWMN_RS08995universal stress protein UspA  [1] (data from MRSA252)
    NWMN_RS09425S-adenosylmethionine synthase  [1] (data from MRSA252)
    NWMN_RS10560aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B  [1] (data from MRSA252)
    NWMN_RS11715UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [1] (data from MRSA252)
    NWMN_RS1234030S ribosomal protein S5  [1] (data from MRSA252)
    NWMN_RS1239530S ribosomal protein S3  [1] (data from MRSA252)
    NWMN_RS1240050S ribosomal protein L22  [1] (data from MRSA252)
    NWMN_RS1241550S ribosomal protein L23  [1] (data from MRSA252)

Localization[edit source | edit]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • Ymax: 0.143
    • Ymax_pos: 11
    • Cmax: 0.121
    • Cmax_pos: 37
    • Smax: 0.257
    • Smax_pos: 4
    • Smean: 0.205
    • D: 0.167
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit source | edit]

  • GI: 447172029 NCBI
  • RefSeq: WP_001249285 NCBI
  • UniProt:

Protein sequence[edit source | edit]

  • MRQKTLDVLEFEKIKSLVANETISDLGLEKVNQMMPATNFETVVFQMEETDEIAQIYNKHRLPSLSGLSKVSAFIHRADIGGVLNVSELNLIKRLIQVQNQFKTFYNQLVEEDEGVKYPILDDKMNQLPVLTDLFQQINETCDTYDLYDNASYELQGIRSKISSTNQRIRQNLDRIVKSQANQKKLSDAIVTVRNERNVIPVKAEYRQDFNGIVHDQSASGQTLYIEPSSVVEMNNQISRLRHDEAIEKERILTQLTGYVAADKDALLVAEQVMGQLDFLIAKARYSRSIKGTKPIFKEDRTVYLPKAYHPLLNRETVVANTIEFMEDIETVIITGPNTGGKTVTLKTLGLIIVMAQSGLLIPTLDGSQLSVFKNVYCDIGDEQSIEQSLSTFSSHMTNIVEILKHADKHSLVLFDELGAGTDPSEGAALAMSILDHVRKIGSLVMATTHYPELKAYSYNREGVMNASVEFDVDTLSPTYKLLMGVPGRSNAFDISKKLGLSLNIINKAKTMIGTDEKEINEMIESLERNYKRVETQRLELDRLVKEAEQVHDDLSKQYQQFQNYEKSLIEEAKEKANQKIKAATKEADDIIKDLRQLREQKGADVKEHELIDKKKRLDDHYEAKSIKQNVQKQKYDKIVAGDEVKVLSYGQKGEVLEIVNDEEAIVQMGIIKMKLPIEDLEKKQKEKVKPTKMVTRQNRQTIKTELDLRGYRYEDALIELDQYLDQAVLSNYEQVYIIHGKGTGALQKGVQQHLKKHKSVSDFRGGMPSEGGFGVTVATLK

Experimental data[edit source | edit]

  • experimentally validated: no data available

Expression & Regulation[edit source | edit]

Operon[edit source | edit]

  • NWMN_RS05965 no polycistronic organisation predicted

Regulation[edit source | edit]

  • sigma factor:
  • regulator:

Transcription pattern[edit source | edit]

Protein synthesis (provided by Aureolib)[edit source | edit]

Protein stability[edit source | edit]

  • half-life: no data available

Biological Material[edit source | edit]

Mutants[edit source | edit]

Expression vector[edit source | edit]

lacZ fusion[edit source | edit]

GFP fusion[edit source | edit]

two-hybrid system[edit source | edit]

FLAG-tag construct[edit source | edit]

Antibody[edit source | edit]

Other Information[edit source | edit]

You are kindly invited to share additional interesting facts.

Literature[edit source | edit]

References[edit source | edit]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J. Proteome Res.: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit source | edit]